FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624508_at:

>probe:Drosophila_2:1624508_at:277:685; Interrogation_Position=136; Antisense; TATCGACGAACTGAGGGATGCCTTT
>probe:Drosophila_2:1624508_at:553:451; Interrogation_Position=170; Antisense; GATCTGGACTCGAATGGCACATTAT
>probe:Drosophila_2:1624508_at:571:293; Interrogation_Position=202; Antisense; CGAGGTGCGACTGGCTCTAATATCA
>probe:Drosophila_2:1624508_at:246:439; Interrogation_Position=245; Antisense; GAGGCAGAGTTGTACGATCTCATCC
>probe:Drosophila_2:1624508_at:20:453; Interrogation_Position=260; Antisense; GATCTCATCCATTCGGTGGCTGTGA
>probe:Drosophila_2:1624508_at:402:17; Interrogation_Position=313; Antisense; ATTTATACGCATGATGGCGCCCCGA
>probe:Drosophila_2:1624508_at:632:217; Interrogation_Position=361; Antisense; AAGTCTATGCCGGACCTTTAACATG
>probe:Drosophila_2:1624508_at:671:661; Interrogation_Position=379; Antisense; TAACATGATTGACCGCGATCGCGAC
>probe:Drosophila_2:1624508_at:177:291; Interrogation_Position=415; Antisense; CGTCCAGGATGTTCGTGCCATTATG
>probe:Drosophila_2:1624508_at:254:627; Interrogation_Position=430; Antisense; TGCCATTATGGTCGTCCTGGGCGAA
>probe:Drosophila_2:1624508_at:207:323; Interrogation_Position=526; Antisense; GCGCGATTTCGTAGGCTTTATGCAC
>probe:Drosophila_2:1624508_at:523:681; Interrogation_Position=544; Antisense; TATGCACAGCCCCATTTGAGCTGAG
>probe:Drosophila_2:1624508_at:459:477; Interrogation_Position=80; Antisense; GTTTTATTTGCTAGTGCCATGCCTT
>probe:Drosophila_2:1624508_at:25:49; Interrogation_Position=98; Antisense; ATGCCTTCTTTTTCCGGCAATGAGC

Paste this into a BLAST search page for me
TATCGACGAACTGAGGGATGCCTTTGATCTGGACTCGAATGGCACATTATCGAGGTGCGACTGGCTCTAATATCAGAGGCAGAGTTGTACGATCTCATCCGATCTCATCCATTCGGTGGCTGTGAATTTATACGCATGATGGCGCCCCGAAAGTCTATGCCGGACCTTTAACATGTAACATGATTGACCGCGATCGCGACCGTCCAGGATGTTCGTGCCATTATGTGCCATTATGGTCGTCCTGGGCGAAGCGCGATTTCGTAGGCTTTATGCACTATGCACAGCCCCATTTGAGCTGAGGTTTTATTTGCTAGTGCCATGCCTTATGCCTTCTTTTTCCGGCAATGAGC

Full Affymetrix probeset data:

Annotations for 1624508_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720