FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624509_at:

>probe:Drosophila_2:1624509_at:40:65; Interrogation_Position=1221; Antisense; ATGGGTATGACCGACGTTTGGATCA
>probe:Drosophila_2:1624509_at:79:297; Interrogation_Position=1286; Antisense; CGAACAGGAGTTTGAGCGCCTCACT
>probe:Drosophila_2:1624509_at:486:317; Interrogation_Position=1388; Antisense; GCCTGTGGCCAGCAACTACAAGTTG
>probe:Drosophila_2:1624509_at:261:75; Interrogation_Position=1426; Antisense; AGGAGCGTGGAATAGCCCTTAGCCA
>probe:Drosophila_2:1624509_at:481:707; Interrogation_Position=1444; Antisense; TTAGCCACCTGAACGTCTACAAGCA
>probe:Drosophila_2:1624509_at:102:643; Interrogation_Position=1478; Antisense; TCTGCGTGATGAGCCTACTTTGAAG
>probe:Drosophila_2:1624509_at:207:377; Interrogation_Position=1499; Antisense; GAAGCAGGGTGATGTCTCCGTAACA
>probe:Drosophila_2:1624509_at:718:485; Interrogation_Position=1512; Antisense; GTCTCCGTAACAGCCATTGGTCCAA
>probe:Drosophila_2:1624509_at:291:729; Interrogation_Position=1528; Antisense; TTGGTCCAAATGTGCTGGCCTTCAA
>probe:Drosophila_2:1624509_at:354:579; Interrogation_Position=1544; Antisense; GGCCTTCAAGCGATCTTTGGCGGGC
>probe:Drosophila_2:1624509_at:675:689; Interrogation_Position=1559; Antisense; TTTGGCGGGCTACAAGTCGTACATC
>probe:Drosophila_2:1624509_at:244:43; Interrogation_Position=1613; Antisense; ATCGATCAACTTGGACTCTGTCTTC
>probe:Drosophila_2:1624509_at:278:85; Interrogation_Position=1683; Antisense; AGTGTGCGTCGCAAGAACGACCTCA
>probe:Drosophila_2:1624509_at:686:603; Interrogation_Position=1729; Antisense; TGTTGCCCAAGGAAGCAGTTGTGCT

Paste this into a BLAST search page for me
ATGGGTATGACCGACGTTTGGATCACGAACAGGAGTTTGAGCGCCTCACTGCCTGTGGCCAGCAACTACAAGTTGAGGAGCGTGGAATAGCCCTTAGCCATTAGCCACCTGAACGTCTACAAGCATCTGCGTGATGAGCCTACTTTGAAGGAAGCAGGGTGATGTCTCCGTAACAGTCTCCGTAACAGCCATTGGTCCAATTGGTCCAAATGTGCTGGCCTTCAAGGCCTTCAAGCGATCTTTGGCGGGCTTTGGCGGGCTACAAGTCGTACATCATCGATCAACTTGGACTCTGTCTTCAGTGTGCGTCGCAAGAACGACCTCATGTTGCCCAAGGAAGCAGTTGTGCT

Full Affymetrix probeset data:

Annotations for 1624509_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720