Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624510_at:

>probe:Drosophila_2:1624510_at:251:205; Interrogation_Position=2221; Antisense; AAGCCTGCGACTGAGACGCGTACCA
>probe:Drosophila_2:1624510_at:400:683; Interrogation_Position=2279; Antisense; TATCGCTGCAACGAGCCCAAAGTCT
>probe:Drosophila_2:1624510_at:254:415; Interrogation_Position=2291; Antisense; GAGCCCAAAGTCTGCAGACCGTGGA
>probe:Drosophila_2:1624510_at:47:261; Interrogation_Position=2320; Antisense; CACCCCTGTGCGGATATCGAACGAA
>probe:Drosophila_2:1624510_at:192:459; Interrogation_Position=2332; Antisense; GATATCGAACGAAAGCGGCCCATGA
>probe:Drosophila_2:1624510_at:563:577; Interrogation_Position=2348; Antisense; GGCCCATGAAGAGGGTCCACCACAA
>probe:Drosophila_2:1624510_at:449:425; Interrogation_Position=2411; Antisense; GAGAGGGCCAGACCATGCTCATCGA
>probe:Drosophila_2:1624510_at:416:619; Interrogation_Position=2426; Antisense; TGCTCATCGAGAACTGCAGTCCCAT
>probe:Drosophila_2:1624510_at:300:565; Interrogation_Position=2471; Antisense; GGCACAAGCTCATCTAGAAACCCGA
>probe:Drosophila_2:1624510_at:496:373; Interrogation_Position=2526; Antisense; GAAGTAGCTTAATCCTCGACCGATC
>probe:Drosophila_2:1624510_at:388:187; Interrogation_Position=2574; Antisense; AACAGGCGGACATGTGCAAAATTAC
>probe:Drosophila_2:1624510_at:64:687; Interrogation_Position=2608; Antisense; TATAATTTTAACCAGCTCCCAAGTG
>probe:Drosophila_2:1624510_at:694:89; Interrogation_Position=2690; Antisense; AGTAGGGCTTGGCTATCAACATTTA
>probe:Drosophila_2:1624510_at:155:365; Interrogation_Position=2784; Antisense; GAATACACGAATATTTTCACCTACT

Paste this into a BLAST search page for me
AAGCCTGCGACTGAGACGCGTACCATATCGCTGCAACGAGCCCAAAGTCTGAGCCCAAAGTCTGCAGACCGTGGACACCCCTGTGCGGATATCGAACGAAGATATCGAACGAAAGCGGCCCATGAGGCCCATGAAGAGGGTCCACCACAAGAGAGGGCCAGACCATGCTCATCGATGCTCATCGAGAACTGCAGTCCCATGGCACAAGCTCATCTAGAAACCCGAGAAGTAGCTTAATCCTCGACCGATCAACAGGCGGACATGTGCAAAATTACTATAATTTTAACCAGCTCCCAAGTGAGTAGGGCTTGGCTATCAACATTTAGAATACACGAATATTTTCACCTACT

Full Affymetrix probeset data:

Annotations for 1624510_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime