FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624512_at:

>probe:Drosophila_2:1624512_at:253:465; Interrogation_Position=196; Antisense; GTTCGCAGTGTAATGCCACCGGTAC
>probe:Drosophila_2:1624512_at:216:539; Interrogation_Position=252; Antisense; GGTAGTCACCTATCAGTCGTTGTGC
>probe:Drosophila_2:1624512_at:58:15; Interrogation_Position=314; Antisense; ATTACCGTCCCAATCACTATGTGGA
>probe:Drosophila_2:1624512_at:210:589; Interrogation_Position=335; Antisense; TGGAGGTTACATGTGCCCACAACTA
>probe:Drosophila_2:1624512_at:89:353; Interrogation_Position=366; Antisense; GCAGCCCTCGAGGAACTATAACTAT
>probe:Drosophila_2:1624512_at:136:527; Interrogation_Position=405; Antisense; GGGCAATGAACTGCTCCGAGCTCTG
>probe:Drosophila_2:1624512_at:553:353; Interrogation_Position=497; Antisense; GCACCATCCATCTGATTCGACTGAA
>probe:Drosophila_2:1624512_at:678:601; Interrogation_Position=509; Antisense; TGATTCGACTGAATGACGCCTCCGG
>probe:Drosophila_2:1624512_at:658:315; Interrogation_Position=526; Antisense; GCCTCCGGCTGCTGGGAATCAGAGA
>probe:Drosophila_2:1624512_at:331:141; Interrogation_Position=556; Antisense; ACGGTGCCCTCTGGTTGTGAGTGCA
>probe:Drosophila_2:1624512_at:596:509; Interrogation_Position=576; Antisense; GTGCATGTGGCCGAAGCATAGCTAC
>probe:Drosophila_2:1624512_at:421:575; Interrogation_Position=601; Antisense; GGCGATATAGCCTTCTACCATCAGG
>probe:Drosophila_2:1624512_at:461:411; Interrogation_Position=659; Antisense; GACCCCATGCACCAATCAATGTGGA
>probe:Drosophila_2:1624512_at:598:313; Interrogation_Position=707; Antisense; GCCAGCTGACCCTGAGGACGAGGAA

Paste this into a BLAST search page for me
GTTCGCAGTGTAATGCCACCGGTACGGTAGTCACCTATCAGTCGTTGTGCATTACCGTCCCAATCACTATGTGGATGGAGGTTACATGTGCCCACAACTAGCAGCCCTCGAGGAACTATAACTATGGGCAATGAACTGCTCCGAGCTCTGGCACCATCCATCTGATTCGACTGAATGATTCGACTGAATGACGCCTCCGGGCCTCCGGCTGCTGGGAATCAGAGAACGGTGCCCTCTGGTTGTGAGTGCAGTGCATGTGGCCGAAGCATAGCTACGGCGATATAGCCTTCTACCATCAGGGACCCCATGCACCAATCAATGTGGAGCCAGCTGACCCTGAGGACGAGGAA

Full Affymetrix probeset data:

Annotations for 1624512_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720