Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624513_at:

>probe:Drosophila_2:1624513_at:103:123; Interrogation_Position=1480; Antisense; AGCGCTCAAAGCAGAACAATCCCAC
>probe:Drosophila_2:1624513_at:707:553; Interrogation_Position=1532; Antisense; GGAGCGACGCCAGCAAAAGCGCAAT
>probe:Drosophila_2:1624513_at:152:145; Interrogation_Position=1572; Antisense; ACTCCAGTTCCCCAAGCAGATAATA
>probe:Drosophila_2:1624513_at:642:177; Interrogation_Position=1623; Antisense; AAACTTGAAGCTTCGCGAGCAGCGA
>probe:Drosophila_2:1624513_at:575:265; Interrogation_Position=1677; Antisense; CAGTTGAGCGATGTTCAGGGCGATT
>probe:Drosophila_2:1624513_at:109:713; Interrogation_Position=1690; Antisense; TTCAGGGCGATTTTGTCGGCACGGC
>probe:Drosophila_2:1624513_at:266:355; Interrogation_Position=1726; Antisense; GCACCTCGCTGAAGATGCGATCCAA
>probe:Drosophila_2:1624513_at:565:209; Interrogation_Position=1821; Antisense; AAGAAGATACGCGAGTCCCACCTGG
>probe:Drosophila_2:1624513_at:719:309; Interrogation_Position=1838; Antisense; CCACCTGGCAGAGCGCAAGGCAAAT
>probe:Drosophila_2:1624513_at:443:655; Interrogation_Position=1862; Antisense; TAATCGGCCCAAGCAAGGACGCAAG
>probe:Drosophila_2:1624513_at:256:641; Interrogation_Position=1904; Antisense; TCGGCCCCTAATTAATAAGTACAAG
>probe:Drosophila_2:1624513_at:89:107; Interrogation_Position=1981; Antisense; AGAAGCCTAAGCGTACCAAGTGGTA
>probe:Drosophila_2:1624513_at:430:83; Interrogation_Position=1999; Antisense; AGTGGTACACGGAGTAGCGCTCCCT
>probe:Drosophila_2:1624513_at:729:123; Interrogation_Position=2014; Antisense; AGCGCTCCCTCTTCTAGGATAAGAA

Paste this into a BLAST search page for me
AGCGCTCAAAGCAGAACAATCCCACGGAGCGACGCCAGCAAAAGCGCAATACTCCAGTTCCCCAAGCAGATAATAAAACTTGAAGCTTCGCGAGCAGCGACAGTTGAGCGATGTTCAGGGCGATTTTCAGGGCGATTTTGTCGGCACGGCGCACCTCGCTGAAGATGCGATCCAAAAGAAGATACGCGAGTCCCACCTGGCCACCTGGCAGAGCGCAAGGCAAATTAATCGGCCCAAGCAAGGACGCAAGTCGGCCCCTAATTAATAAGTACAAGAGAAGCCTAAGCGTACCAAGTGGTAAGTGGTACACGGAGTAGCGCTCCCTAGCGCTCCCTCTTCTAGGATAAGAA

Full Affymetrix probeset data:

Annotations for 1624513_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime