Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624514_at:

>probe:Drosophila_2:1624514_at:362:25; Interrogation_Position=114; Antisense; ATATGGAACGGCCAAGTCGGGCACT
>probe:Drosophila_2:1624514_at:668:141; Interrogation_Position=136; Antisense; ACTGGGATTGCAGCCATGGCCGTAA
>probe:Drosophila_2:1624514_at:233:575; Interrogation_Position=152; Antisense; TGGCCGTAATGCGACCCGAATTGAT
>probe:Drosophila_2:1624514_at:688:15; Interrogation_Position=187; Antisense; ATTATTCCCGTTGTGATGGCTGGTA
>probe:Drosophila_2:1624514_at:472:483; Interrogation_Position=209; Antisense; GTATCATTGCGATCTATGGCCTGGT
>probe:Drosophila_2:1624514_at:616:317; Interrogation_Position=250; Antisense; GCCGGATCTCTGTCGGATTCGTATA
>probe:Drosophila_2:1624514_at:187:11; Interrogation_Position=266; Antisense; ATTCGTATACCATTCGCAAGGGATA
>probe:Drosophila_2:1624514_at:217:223; Interrogation_Position=283; Antisense; AAGGGATACATCCACCTGGCAGCCG
>probe:Drosophila_2:1624514_at:533:15; Interrogation_Position=309; Antisense; ATTATCGGTGGGTTTCGCCGGATTG
>probe:Drosophila_2:1624514_at:535:535; Interrogation_Position=36; Antisense; GGATAAGCCGGCGTACTCGTTCTTC
>probe:Drosophila_2:1624514_at:361:451; Interrogation_Position=426; Antisense; GATCTTCGCCGAGGTACTGGGTCTG
>probe:Drosophila_2:1624514_at:533:141; Interrogation_Position=441; Antisense; ACTGGGTCTGTATGGGCTGATCGTC
>probe:Drosophila_2:1624514_at:500:291; Interrogation_Position=53; Antisense; CGTTCTTCTTTGGTTCGATGGGAGC
>probe:Drosophila_2:1624514_at:284:37; Interrogation_Position=88; Antisense; ATCATCTTTTCAGCCTTGGGAGCGG

Paste this into a BLAST search page for me
ATATGGAACGGCCAAGTCGGGCACTACTGGGATTGCAGCCATGGCCGTAATGGCCGTAATGCGACCCGAATTGATATTATTCCCGTTGTGATGGCTGGTAGTATCATTGCGATCTATGGCCTGGTGCCGGATCTCTGTCGGATTCGTATAATTCGTATACCATTCGCAAGGGATAAAGGGATACATCCACCTGGCAGCCGATTATCGGTGGGTTTCGCCGGATTGGGATAAGCCGGCGTACTCGTTCTTCGATCTTCGCCGAGGTACTGGGTCTGACTGGGTCTGTATGGGCTGATCGTCCGTTCTTCTTTGGTTCGATGGGAGCATCATCTTTTCAGCCTTGGGAGCGG

Full Affymetrix probeset data:

Annotations for 1624514_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime