FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624515_at:

>probe:Drosophila_2:1624515_at:378:61; Interrogation_Position=1674; Antisense; ATGTCCTCGATGAGTCCGTGCATTA
>probe:Drosophila_2:1624515_at:194:305; Interrogation_Position=1689; Antisense; CCGTGCATTATTGTTGACCAGGAAG
>probe:Drosophila_2:1624515_at:371:553; Interrogation_Position=1734; Antisense; GGAGCAGCAGGTGGCACTCGCATCA
>probe:Drosophila_2:1624515_at:1:335; Interrogation_Position=1773; Antisense; GCTGTGATCATGAAGTACCTGCTAC
>probe:Drosophila_2:1624515_at:514:673; Interrogation_Position=1788; Antisense; TACCTGCTACGCAAGGAGAGCCTCA
>probe:Drosophila_2:1624515_at:83:635; Interrogation_Position=1853; Antisense; TCCCATGCGCGTGAGCTATGAGCAG
>probe:Drosophila_2:1624515_at:10:81; Interrogation_Position=1879; Antisense; AGGTGGACAGCAGCGTTACCGACTA
>probe:Drosophila_2:1624515_at:442:1; Interrogation_Position=1924; Antisense; AGATGTACGAGGAGCCCGTCGGCTC
>probe:Drosophila_2:1624515_at:182:117; Interrogation_Position=1950; Antisense; AGCTTTGCAGCAGTGACCGCCATTG
>probe:Drosophila_2:1624515_at:369:113; Interrogation_Position=1984; Antisense; AGCAGCCGGAGCCATTCTATGATCG
>probe:Drosophila_2:1624515_at:171:717; Interrogation_Position=2094; Antisense; TTCGTAAGTCGCATGAGCCGTGGCC
>probe:Drosophila_2:1624515_at:691:317; Interrogation_Position=2110; Antisense; GCCGTGGCCTGCGAGTAATGTTTAC
>probe:Drosophila_2:1624515_at:356:657; Interrogation_Position=2183; Antisense; TAACTACCAGGCTGTGAGTGCCCGA
>probe:Drosophila_2:1624515_at:560:511; Interrogation_Position=2196; Antisense; GTGAGTGCCCGATATATCCAAATAA

Paste this into a BLAST search page for me
ATGTCCTCGATGAGTCCGTGCATTACCGTGCATTATTGTTGACCAGGAAGGGAGCAGCAGGTGGCACTCGCATCAGCTGTGATCATGAAGTACCTGCTACTACCTGCTACGCAAGGAGAGCCTCATCCCATGCGCGTGAGCTATGAGCAGAGGTGGACAGCAGCGTTACCGACTAAGATGTACGAGGAGCCCGTCGGCTCAGCTTTGCAGCAGTGACCGCCATTGAGCAGCCGGAGCCATTCTATGATCGTTCGTAAGTCGCATGAGCCGTGGCCGCCGTGGCCTGCGAGTAATGTTTACTAACTACCAGGCTGTGAGTGCCCGAGTGAGTGCCCGATATATCCAAATAA

Full Affymetrix probeset data:

Annotations for 1624515_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720