FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624517_at:

>probe:Drosophila_2:1624517_at:298:553; Interrogation_Position=1697; Antisense; GGAGCAGCTGATTACCCAGTCGGAT
>probe:Drosophila_2:1624517_at:54:59; Interrogation_Position=1720; Antisense; ATGAGGCAGTTCGTCAGGGCTTCCA
>probe:Drosophila_2:1624517_at:469:699; Interrogation_Position=1789; Antisense; TTTACCACGGTCAACTGGACATCCA
>probe:Drosophila_2:1624517_at:45:565; Interrogation_Position=1817; Antisense; GGAATCTGATCTGGCGGACACCTAT
>probe:Drosophila_2:1624517_at:620:183; Interrogation_Position=1888; Antisense; AAAATCTCGGCAGGTATTGGCCCCT
>probe:Drosophila_2:1624517_at:596:689; Interrogation_Position=1902; Antisense; TATTGGCCCCTGGTGGGACCTCAAG
>probe:Drosophila_2:1624517_at:324:555; Interrogation_Position=1917; Antisense; GGACCTCAAGTCACCCTGTATGTTC
>probe:Drosophila_2:1624517_at:148:651; Interrogation_Position=1954; Antisense; TCAAGGCGGGCTCAAATCGACTGGT
>probe:Drosophila_2:1624517_at:250:519; Interrogation_Position=1983; Antisense; GTGGAGTATCAGCAGACACCCGCCT
>probe:Drosophila_2:1624517_at:366:651; Interrogation_Position=2007; Antisense; TCACAGGAGCTGCACTTCCGAGATA
>probe:Drosophila_2:1624517_at:62:419; Interrogation_Position=2041; Antisense; TGAACGCGAGGACCGTTTAGTCGTC
>probe:Drosophila_2:1624517_at:326:705; Interrogation_Position=2057; Antisense; TTAGTCGTCGGCCTAAGGACCATTG
>probe:Drosophila_2:1624517_at:490:225; Interrogation_Position=2071; Antisense; AAGGACCATTGCGACTTGCATCCAT
>probe:Drosophila_2:1624517_at:445:723; Interrogation_Position=2086; Antisense; TTGCATCCATCGCTGTAGCCATAAA

Paste this into a BLAST search page for me
GGAGCAGCTGATTACCCAGTCGGATATGAGGCAGTTCGTCAGGGCTTCCATTTACCACGGTCAACTGGACATCCAGGAATCTGATCTGGCGGACACCTATAAAATCTCGGCAGGTATTGGCCCCTTATTGGCCCCTGGTGGGACCTCAAGGGACCTCAAGTCACCCTGTATGTTCTCAAGGCGGGCTCAAATCGACTGGTGTGGAGTATCAGCAGACACCCGCCTTCACAGGAGCTGCACTTCCGAGATATGAACGCGAGGACCGTTTAGTCGTCTTAGTCGTCGGCCTAAGGACCATTGAAGGACCATTGCGACTTGCATCCATTTGCATCCATCGCTGTAGCCATAAA

Full Affymetrix probeset data:

Annotations for 1624517_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720