FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624518_at:

>probe:Drosophila_2:1624518_at:128:149; Interrogation_Position=1033; Antisense; ACTTGGCCCGTCATCCAACGAGGAA
>probe:Drosophila_2:1624518_at:440:417; Interrogation_Position=1127; Antisense; GAGCTTCCCACACGCTTAGAGGGAA
>probe:Drosophila_2:1624518_at:294:585; Interrogation_Position=594; Antisense; TGTGACGTTTCCTCGGCGAAGGCGC
>probe:Drosophila_2:1624518_at:420:379; Interrogation_Position=627; Antisense; GAAGCCAAAGTTCTGGTGTGCCAGC
>probe:Drosophila_2:1624518_at:39:599; Interrogation_Position=643; Antisense; TGTGCCAGCTGGAGACGCCCGTTGA
>probe:Drosophila_2:1624518_at:187:573; Interrogation_Position=699; Antisense; GGCGTGTCCATCGTCAATGCGGCTC
>probe:Drosophila_2:1624518_at:122:385; Interrogation_Position=747; Antisense; GAACTTCTTCAGTTGGCCAGCATCT
>probe:Drosophila_2:1624518_at:668:579; Interrogation_Position=761; Antisense; GGCCAGCATCTTCTGTGTGAACGAA
>probe:Drosophila_2:1624518_at:466:173; Interrogation_Position=784; Antisense; AAAGCGAGGCGGCACTGATGACTCA
>probe:Drosophila_2:1624518_at:26:607; Interrogation_Position=799; Antisense; TGATGACTCAGATGCCCGACATTGG
>probe:Drosophila_2:1624518_at:520:569; Interrogation_Position=866; Antisense; GGCAGGTGCCAACACGGTGATCATA
>probe:Drosophila_2:1624518_at:53:533; Interrogation_Position=881; Antisense; GGTGATCATAACTCTGGGCAAACTA
>probe:Drosophila_2:1624518_at:509:403; Interrogation_Position=927; Antisense; GACTCCAAGGGCGTGTGCCAGCATG
>probe:Drosophila_2:1624518_at:707:623; Interrogation_Position=956; Antisense; TGCGCCGAGTGTGCCGCCCGAAAAA

Paste this into a BLAST search page for me
ACTTGGCCCGTCATCCAACGAGGAAGAGCTTCCCACACGCTTAGAGGGAATGTGACGTTTCCTCGGCGAAGGCGCGAAGCCAAAGTTCTGGTGTGCCAGCTGTGCCAGCTGGAGACGCCCGTTGAGGCGTGTCCATCGTCAATGCGGCTCGAACTTCTTCAGTTGGCCAGCATCTGGCCAGCATCTTCTGTGTGAACGAAAAAGCGAGGCGGCACTGATGACTCATGATGACTCAGATGCCCGACATTGGGGCAGGTGCCAACACGGTGATCATAGGTGATCATAACTCTGGGCAAACTAGACTCCAAGGGCGTGTGCCAGCATGTGCGCCGAGTGTGCCGCCCGAAAAA

Full Affymetrix probeset data:

Annotations for 1624518_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720