Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624519_at:

>probe:Drosophila_2:1624519_at:293:81; Interrogation_Position=1002; Antisense; AGGGCAACGTGCACTCGTGGGACAC
>probe:Drosophila_2:1624519_at:285:55; Interrogation_Position=1028; Antisense; ATGAAGCAGCGGCACACGGGCACAC
>probe:Drosophila_2:1624519_at:499:523; Interrogation_Position=1045; Antisense; GGGCACACTGTCTGGTCACGAGAAC
>probe:Drosophila_2:1624519_at:60:137; Interrogation_Position=1062; Antisense; ACGAGAACCGCATCACTTGCATCAG
>probe:Drosophila_2:1624519_at:424:575; Interrogation_Position=1111; Antisense; GGCGTCCACCAGTTGGGATCAGCAA
>probe:Drosophila_2:1624519_at:505:35; Interrogation_Position=1128; Antisense; ATCAGCAAGTGCGTCTGTGGCTCTA
>probe:Drosophila_2:1624519_at:565:595; Interrogation_Position=1143; Antisense; TGTGGCTCTAATCTGTGCCTCTGAT
>probe:Drosophila_2:1624519_at:274:139; Interrogation_Position=1199; Antisense; ACGTTTATGCGTGCAGTTTGCTTGC
>probe:Drosophila_2:1624519_at:486:475; Interrogation_Position=1231; Antisense; GTATACGTAATATCCATAGCCTGCA
>probe:Drosophila_2:1624519_at:435:487; Interrogation_Position=1424; Antisense; GTAGCCTCCAATAACAAGCAAGTGC
>probe:Drosophila_2:1624519_at:676:553; Interrogation_Position=901; Antisense; GGACCAGCAAATCGCCCAGTATGAA
>probe:Drosophila_2:1624519_at:139:681; Interrogation_Position=920; Antisense; TATGAACCGCCCCAGAAGAACACTG
>probe:Drosophila_2:1624519_at:594:211; Interrogation_Position=935; Antisense; AAGAACACTGGCTTCACGTCGTGCG
>probe:Drosophila_2:1624519_at:156:341; Interrogation_Position=978; Antisense; GCTACCTCATGTGCGGCGGCATTGA

Paste this into a BLAST search page for me
AGGGCAACGTGCACTCGTGGGACACATGAAGCAGCGGCACACGGGCACACGGGCACACTGTCTGGTCACGAGAACACGAGAACCGCATCACTTGCATCAGGGCGTCCACCAGTTGGGATCAGCAAATCAGCAAGTGCGTCTGTGGCTCTATGTGGCTCTAATCTGTGCCTCTGATACGTTTATGCGTGCAGTTTGCTTGCGTATACGTAATATCCATAGCCTGCAGTAGCCTCCAATAACAAGCAAGTGCGGACCAGCAAATCGCCCAGTATGAATATGAACCGCCCCAGAAGAACACTGAAGAACACTGGCTTCACGTCGTGCGGCTACCTCATGTGCGGCGGCATTGA

Full Affymetrix probeset data:

Annotations for 1624519_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime