Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624523_at:

>probe:Drosophila_2:1624523_at:335:617; Interrogation_Position=4570; Antisense; TGCAGATCGACATCCTGATCGATAT
>probe:Drosophila_2:1624523_at:144:443; Interrogation_Position=4650; Antisense; GATGTTGCTTTGACAAGCCAAGCTA
>probe:Drosophila_2:1624523_at:671:311; Interrogation_Position=4666; Antisense; GCCAAGCTACTACTTCAATTTCGAA
>probe:Drosophila_2:1624523_at:477:483; Interrogation_Position=4816; Antisense; GTATACACTGTATCGATGGCTATTT
>probe:Drosophila_2:1624523_at:687:479; Interrogation_Position=4842; Antisense; GTATTAAGACTCTCGATCCGCAACC
>probe:Drosophila_2:1624523_at:633:301; Interrogation_Position=4865; Antisense; CCGCATTCCCTTTACTTTAAGAGCT
>probe:Drosophila_2:1624523_at:279:103; Interrogation_Position=4884; Antisense; AGAGCTGGACTCTAATCGCAGCCAA
>probe:Drosophila_2:1624523_at:528:449; Interrogation_Position=4910; Antisense; GATTGCGCAAACATTTTGGTTCCCC
>probe:Drosophila_2:1624523_at:309:11; Interrogation_Position=4944; Antisense; ATTCGATTCCGTTGTCCTTTCTGTC
>probe:Drosophila_2:1624523_at:279:629; Interrogation_Position=4977; Antisense; TCCAGAGCTACCACAGCCAATTGAT
>probe:Drosophila_2:1624523_at:674:53; Interrogation_Position=5007; Antisense; ATGAATCCTGGCCATGGTCAGCAGC
>probe:Drosophila_2:1624523_at:413:517; Interrogation_Position=5037; Antisense; GTGGGTGGAACTCCATCCATAACCA
>probe:Drosophila_2:1624523_at:486:307; Interrogation_Position=5053; Antisense; CCATAACCATGGATACTGCGCGATG
>probe:Drosophila_2:1624523_at:281:577; Interrogation_Position=5095; Antisense; GGCCGTCCTGGAACATCTGAGAATT

Paste this into a BLAST search page for me
TGCAGATCGACATCCTGATCGATATGATGTTGCTTTGACAAGCCAAGCTAGCCAAGCTACTACTTCAATTTCGAAGTATACACTGTATCGATGGCTATTTGTATTAAGACTCTCGATCCGCAACCCCGCATTCCCTTTACTTTAAGAGCTAGAGCTGGACTCTAATCGCAGCCAAGATTGCGCAAACATTTTGGTTCCCCATTCGATTCCGTTGTCCTTTCTGTCTCCAGAGCTACCACAGCCAATTGATATGAATCCTGGCCATGGTCAGCAGCGTGGGTGGAACTCCATCCATAACCACCATAACCATGGATACTGCGCGATGGGCCGTCCTGGAACATCTGAGAATT

Full Affymetrix probeset data:

Annotations for 1624523_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime