FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624525_at:

>probe:Drosophila_2:1624525_at:147:79; Interrogation_Position=116; Antisense; AGGTATTCATTGTACTCTGCGCACT
>probe:Drosophila_2:1624525_at:516:641; Interrogation_Position=131; Antisense; TCTGCGCACTGGTGGCCTGTGTTTC
>probe:Drosophila_2:1624525_at:522:365; Interrogation_Position=151; Antisense; GTTTCGGCCGGATTGGTCCGATCCT
>probe:Drosophila_2:1624525_at:171:113; Interrogation_Position=205; Antisense; AGCAGCTCCGGATGGAATAGTGGCT
>probe:Drosophila_2:1624525_at:697:19; Interrogation_Position=221; Antisense; ATAGTGGCTGGGTTGCCCAGCAGCC
>probe:Drosophila_2:1624525_at:686:113; Interrogation_Position=239; Antisense; AGCAGCCGCAAGTCATCAAGGTCAT
>probe:Drosophila_2:1624525_at:723:627; Interrogation_Position=26; Antisense; TGCCACACTTCGAGACGCACAGCAA
>probe:Drosophila_2:1624525_at:220:391; Interrogation_Position=371; Antisense; GAAACTCTGGTTGGAGCAGCGGCAA
>probe:Drosophila_2:1624525_at:354:113; Interrogation_Position=385; Antisense; AGCAGCGGCAACTCCGGATGGAACA
>probe:Drosophila_2:1624525_at:438:361; Interrogation_Position=410; Antisense; GCAATGGATGGTCCAGTTCCAGCTC
>probe:Drosophila_2:1624525_at:80:375; Interrogation_Position=460; Antisense; GAAGAGCTACCATCTCTAGGAGACG
>probe:Drosophila_2:1624525_at:328:185; Interrogation_Position=51; Antisense; AACAAACCAGGATCTACTCTCCGAG
>probe:Drosophila_2:1624525_at:636:539; Interrogation_Position=531; Antisense; GGTTCACAATCCACCCGATTTTATA
>probe:Drosophila_2:1624525_at:302:453; Interrogation_Position=61; Antisense; GATCTACTCTCCGAGTCAGGACTAA

Paste this into a BLAST search page for me
AGGTATTCATTGTACTCTGCGCACTTCTGCGCACTGGTGGCCTGTGTTTCGTTTCGGCCGGATTGGTCCGATCCTAGCAGCTCCGGATGGAATAGTGGCTATAGTGGCTGGGTTGCCCAGCAGCCAGCAGCCGCAAGTCATCAAGGTCATTGCCACACTTCGAGACGCACAGCAAGAAACTCTGGTTGGAGCAGCGGCAAAGCAGCGGCAACTCCGGATGGAACAGCAATGGATGGTCCAGTTCCAGCTCGAAGAGCTACCATCTCTAGGAGACGAACAAACCAGGATCTACTCTCCGAGGGTTCACAATCCACCCGATTTTATAGATCTACTCTCCGAGTCAGGACTAA

Full Affymetrix probeset data:

Annotations for 1624525_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720