Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624527_at:

>probe:Drosophila_2:1624527_at:336:123; Interrogation_Position=1550; Antisense; AGCGCAGTGCATTCCGAGCAGCAGG
>probe:Drosophila_2:1624527_at:426:79; Interrogation_Position=1572; Antisense; AGGTTCCCACCTACATAGAGCTGAC
>probe:Drosophila_2:1624527_at:35:111; Interrogation_Position=1601; Antisense; AGCAATCGTCCAGCGGCCATAGGTT
>probe:Drosophila_2:1624527_at:126:271; Interrogation_Position=1618; Antisense; CATAGGTTCCGATAGCCTTAGCTAT
>probe:Drosophila_2:1624527_at:606:705; Interrogation_Position=1635; Antisense; TTAGCTATAGTGCTGCTCCTCAGTA
>probe:Drosophila_2:1624527_at:548:619; Interrogation_Position=1648; Antisense; TGCTCCTCAGTATCCGGTCAGCGGA
>probe:Drosophila_2:1624527_at:687:555; Interrogation_Position=1670; Antisense; GGACTGCCAGGCCAGGACTACAACA
>probe:Drosophila_2:1624527_at:432:185; Interrogation_Position=1691; Antisense; AACAACTCCAGTGTGCTGCAGTACG
>probe:Drosophila_2:1624527_at:398:551; Interrogation_Position=1727; Antisense; GGAGCAAAGCCCTATCGTCCTTGGG
>probe:Drosophila_2:1624527_at:20:303; Interrogation_Position=1763; Antisense; GCCTATTGATTGTGGGCATAAGCCT
>probe:Drosophila_2:1624527_at:305:109; Interrogation_Position=1789; Antisense; AGAAGGGATATTTCAACCTCTAGTC
>probe:Drosophila_2:1624527_at:292:89; Interrogation_Position=1833; Antisense; AGTCTTAAGTTTCGCATCCTACACA
>probe:Drosophila_2:1624527_at:210:295; Interrogation_Position=1881; Antisense; CGCAGTGAGATTAGCTAGTCCCGTA
>probe:Drosophila_2:1624527_at:312:329; Interrogation_Position=1894; Antisense; GCTAGTCCCGTAAGCCTTTAAGCTT

Paste this into a BLAST search page for me
AGCGCAGTGCATTCCGAGCAGCAGGAGGTTCCCACCTACATAGAGCTGACAGCAATCGTCCAGCGGCCATAGGTTCATAGGTTCCGATAGCCTTAGCTATTTAGCTATAGTGCTGCTCCTCAGTATGCTCCTCAGTATCCGGTCAGCGGAGGACTGCCAGGCCAGGACTACAACAAACAACTCCAGTGTGCTGCAGTACGGGAGCAAAGCCCTATCGTCCTTGGGGCCTATTGATTGTGGGCATAAGCCTAGAAGGGATATTTCAACCTCTAGTCAGTCTTAAGTTTCGCATCCTACACACGCAGTGAGATTAGCTAGTCCCGTAGCTAGTCCCGTAAGCCTTTAAGCTT

Full Affymetrix probeset data:

Annotations for 1624527_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime