Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624528_at:

>probe:Drosophila_2:1624528_at:14:377; Interrogation_Position=2007; Antisense; GAAGAAGGTCAAAGCCCATGCTCTT
>probe:Drosophila_2:1624528_at:286:513; Interrogation_Position=2038; Antisense; GTGGCTATACGGGTGGGCATTAACT
>probe:Drosophila_2:1624528_at:370:505; Interrogation_Position=2050; Antisense; GTGGGCATTAACTCGGGACCCGTCG
>probe:Drosophila_2:1624528_at:358:539; Interrogation_Position=2085; Antisense; GGTTGGGATGAAGGTTCCTCGATAC
>probe:Drosophila_2:1624528_at:205:123; Interrogation_Position=2158; Antisense; AGCGATCCCTGGATGATCCAGCTGT
>probe:Drosophila_2:1624528_at:588:443; Interrogation_Position=2169; Antisense; GATGATCCAGCTGTCCAACTATACT
>probe:Drosophila_2:1624528_at:421:597; Interrogation_Position=2180; Antisense; TGTCCAACTATACTGCGCTGAAGGT
>probe:Drosophila_2:1624528_at:407:411; Interrogation_Position=2271; Antisense; GACCTACTGGCTTTTGGAGGGACCA
>probe:Drosophila_2:1624528_at:13:403; Interrogation_Position=2309; Antisense; GACTTGTTTGTCTTGGAAAATCCAG
>probe:Drosophila_2:1624528_at:245:387; Interrogation_Position=2324; Antisense; GAAAATCCAGGAATATCACCACTAT
>probe:Drosophila_2:1624528_at:557:399; Interrogation_Position=2378; Antisense; GACAGAAAATCTTGTAACCCTTTGG
>probe:Drosophila_2:1624528_at:61:491; Interrogation_Position=2391; Antisense; GTAACCCTTTGGAAATAATCAGGCT
>probe:Drosophila_2:1624528_at:382:571; Interrogation_Position=2412; Antisense; GGCTCGAAAACCTCTTATATCTAAT
>probe:Drosophila_2:1624528_at:270:711; Interrogation_Position=2473; Antisense; TTAATCCCCTGTAAAGTATATGTGG

Paste this into a BLAST search page for me
GAAGAAGGTCAAAGCCCATGCTCTTGTGGCTATACGGGTGGGCATTAACTGTGGGCATTAACTCGGGACCCGTCGGGTTGGGATGAAGGTTCCTCGATACAGCGATCCCTGGATGATCCAGCTGTGATGATCCAGCTGTCCAACTATACTTGTCCAACTATACTGCGCTGAAGGTGACCTACTGGCTTTTGGAGGGACCAGACTTGTTTGTCTTGGAAAATCCAGGAAAATCCAGGAATATCACCACTATGACAGAAAATCTTGTAACCCTTTGGGTAACCCTTTGGAAATAATCAGGCTGGCTCGAAAACCTCTTATATCTAATTTAATCCCCTGTAAAGTATATGTGG

Full Affymetrix probeset data:

Annotations for 1624528_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime