FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624529_at:

>probe:Drosophila_2:1624529_at:144:109; Interrogation_Position=121; Antisense; AGAAGTACTACACTCGCCTGACGTT
>probe:Drosophila_2:1624529_at:555:609; Interrogation_Position=139; Antisense; TGACGTTGGACTTCCACACCAACAA
>probe:Drosophila_2:1624529_at:117:217; Interrogation_Position=213; Antisense; AAGATTGCCGGCTATGTCACCCATT
>probe:Drosophila_2:1624529_at:100:623; Interrogation_Position=250; Antisense; TGCGTCACTCCCAGGTGCGTGGTAT
>probe:Drosophila_2:1624529_at:494:329; Interrogation_Position=266; Antisense; GCGTGGTATCTCCATCAAGTTGCAG
>probe:Drosophila_2:1624529_at:89:555; Interrogation_Position=296; Antisense; GGAGCGTGAGCGTCGTGACAACTAC
>probe:Drosophila_2:1624529_at:533:73; Interrogation_Position=346; Antisense; AGGACATCATCGAGGTCGACGCCGA
>probe:Drosophila_2:1624529_at:73:469; Interrogation_Position=383; Antisense; GTTGAAGCTTCTGGACTTCCACAAC
>probe:Drosophila_2:1624529_at:287:255; Interrogation_Position=440; Antisense; CAACAACTTTGGTCGTCGCAACTAA
>probe:Drosophila_2:1624529_at:464:443; Interrogation_Position=488; Antisense; GATGTTCTGATTTGCATGGGATCAC
>probe:Drosophila_2:1624529_at:296:83; Interrogation_Position=594; Antisense; AGTGAACATCGTTTCCAAAGTGGCT
>probe:Drosophila_2:1624529_at:407:355; Interrogation_Position=61; Antisense; GCAACATAATGGGTCGCGTACGAAC
>probe:Drosophila_2:1624529_at:727:581; Interrogation_Position=614; Antisense; TGGCTCACCAGGCAGGAAACTCGAT
>probe:Drosophila_2:1624529_at:581:227; Interrogation_Position=99; Antisense; AAGGCCGCTAAGGTCATCATCGAGA

Paste this into a BLAST search page for me
AGAAGTACTACACTCGCCTGACGTTTGACGTTGGACTTCCACACCAACAAAAGATTGCCGGCTATGTCACCCATTTGCGTCACTCCCAGGTGCGTGGTATGCGTGGTATCTCCATCAAGTTGCAGGGAGCGTGAGCGTCGTGACAACTACAGGACATCATCGAGGTCGACGCCGAGTTGAAGCTTCTGGACTTCCACAACCAACAACTTTGGTCGTCGCAACTAAGATGTTCTGATTTGCATGGGATCACAGTGAACATCGTTTCCAAAGTGGCTGCAACATAATGGGTCGCGTACGAACTGGCTCACCAGGCAGGAAACTCGATAAGGCCGCTAAGGTCATCATCGAGA

Full Affymetrix probeset data:

Annotations for 1624529_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720