FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624534_at:

>probe:Drosophila_2:1624534_at:484:303; Interrogation_Position=347; Antisense; CCGCAATGGTCGCAGATCCGATGAA
>probe:Drosophila_2:1624534_at:547:361; Interrogation_Position=349; Antisense; GCAATGGTCGCAGATCCGATGAATG
>probe:Drosophila_2:1624534_at:436:65; Interrogation_Position=352; Antisense; ATGGTCGCAGATCCGATGAATGAAA
>probe:Drosophila_2:1624534_at:75:445; Interrogation_Position=366; Antisense; GATGAATGAAAGATCCACAGGACCA
>probe:Drosophila_2:1624534_at:623:391; Interrogation_Position=373; Antisense; GAAAGATCCACAGGACCAATAGGAA
>probe:Drosophila_2:1624534_at:334:553; Interrogation_Position=385; Antisense; GGACCAATAGGAAATCCACTCCAAT
>probe:Drosophila_2:1624534_at:116:311; Interrogation_Position=405; Antisense; CCAATCCCAATGCTGAACCCAATGA
>probe:Drosophila_2:1624534_at:653:45; Interrogation_Position=408; Antisense; ATCCCAATGCTGAACCCAATGACAA
>probe:Drosophila_2:1624534_at:533:381; Interrogation_Position=419; Antisense; GAACCCAATGACAACCATAGCACTT
>probe:Drosophila_2:1624534_at:284:231; Interrogation_Position=425; Antisense; AATGACAACCATAGCACTTAACTTT
>probe:Drosophila_2:1624534_at:120:397; Interrogation_Position=428; Antisense; GACAACCATAGCACTTAACTTTTGA
>probe:Drosophila_2:1624534_at:659:127; Interrogation_Position=432; Antisense; ACCATAGCACTTAACTTTTGAATAG
>probe:Drosophila_2:1624534_at:630:101; Interrogation_Position=470; Antisense; AGCAATATTGTTCGTTTATAAGGCA
>probe:Drosophila_2:1624534_at:145:395; Interrogation_Position=510; Antisense; GAAATAGTATTTCTCATGTTGAATT

Paste this into a BLAST search page for me
CCGCAATGGTCGCAGATCCGATGAAGCAATGGTCGCAGATCCGATGAATGATGGTCGCAGATCCGATGAATGAAAGATGAATGAAAGATCCACAGGACCAGAAAGATCCACAGGACCAATAGGAAGGACCAATAGGAAATCCACTCCAATCCAATCCCAATGCTGAACCCAATGAATCCCAATGCTGAACCCAATGACAAGAACCCAATGACAACCATAGCACTTAATGACAACCATAGCACTTAACTTTGACAACCATAGCACTTAACTTTTGAACCATAGCACTTAACTTTTGAATAGAGCAATATTGTTCGTTTATAAGGCAGAAATAGTATTTCTCATGTTGAATT

Full Affymetrix probeset data:

Annotations for 1624534_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720