Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624535_at:

>probe:Drosophila_2:1624535_at:689:257; Interrogation_Position=1008; Antisense; CACGGAGCACACTCGGTTTGTAAAT
>probe:Drosophila_2:1624535_at:384:139; Interrogation_Position=1057; Antisense; ACGTAGCTTAATGAGTGTGGCGAAA
>probe:Drosophila_2:1624535_at:263:31; Interrogation_Position=1081; Antisense; ATAAGACGTCGCTTACAGGCATCCC
>probe:Drosophila_2:1624535_at:496:153; Interrogation_Position=1095; Antisense; ACAGGCATCCCAAACGTCACGAAAT
>probe:Drosophila_2:1624535_at:352:193; Interrogation_Position=1141; Antisense; AACTCGATATACTTACACAATGCAT
>probe:Drosophila_2:1624535_at:220:153; Interrogation_Position=1182; Antisense; ACATGTCGCGATGGTGTGTGAGCAT
>probe:Drosophila_2:1624535_at:441:517; Interrogation_Position=1197; Antisense; GTGTGAGCATGAACGCTCGTGCTAT
>probe:Drosophila_2:1624535_at:593:337; Interrogation_Position=1211; Antisense; GCTCGTGCTATTTTTGTGTACACCA
>probe:Drosophila_2:1624535_at:138:509; Interrogation_Position=1226; Antisense; GTGTACACCAAGTTGAGCTACTTTT
>probe:Drosophila_2:1624535_at:471:279; Interrogation_Position=1243; Antisense; CTACTTTTGTTGTCCGATGTGTCGA
>probe:Drosophila_2:1624535_at:399:163; Interrogation_Position=1286; Antisense; AAATTCGAACGTTCGTCATCGCCAC
>probe:Drosophila_2:1624535_at:491:311; Interrogation_Position=1306; Antisense; GCCACTTCTGCGAGTTACATACGGT
>probe:Drosophila_2:1624535_at:289:473; Interrogation_Position=1329; Antisense; GTTCATATTGAATCACTAGCGCTAG
>probe:Drosophila_2:1624535_at:85:279; Interrogation_Position=1344; Antisense; CTAGCGCTAGAAAACGGGCAATATT

Paste this into a BLAST search page for me
CACGGAGCACACTCGGTTTGTAAATACGTAGCTTAATGAGTGTGGCGAAAATAAGACGTCGCTTACAGGCATCCCACAGGCATCCCAAACGTCACGAAATAACTCGATATACTTACACAATGCATACATGTCGCGATGGTGTGTGAGCATGTGTGAGCATGAACGCTCGTGCTATGCTCGTGCTATTTTTGTGTACACCAGTGTACACCAAGTTGAGCTACTTTTCTACTTTTGTTGTCCGATGTGTCGAAAATTCGAACGTTCGTCATCGCCACGCCACTTCTGCGAGTTACATACGGTGTTCATATTGAATCACTAGCGCTAGCTAGCGCTAGAAAACGGGCAATATT

Full Affymetrix probeset data:

Annotations for 1624535_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime