FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624539_at:

>probe:Drosophila_2:1624539_at:63:435; Interrogation_Position=2880; Antisense; GAGGAGGTTGTACAGCTCGTCACCT
>probe:Drosophila_2:1624539_at:462:725; Interrogation_Position=2991; Antisense; TTGATCTCCGGAACTTTGCGCGAAG
>probe:Drosophila_2:1624539_at:598:505; Interrogation_Position=3076; Antisense; GTGCGAACGGCTGCTTTGGTGCTCA
>probe:Drosophila_2:1624539_at:73:471; Interrogation_Position=3102; Antisense; GTTCGCGTTCCGCAACAAGATGTCG
>probe:Drosophila_2:1624539_at:693:441; Interrogation_Position=3120; Antisense; GATGTCGCCCAGGTGAACTTTTATT
>probe:Drosophila_2:1624539_at:324:237; Interrogation_Position=3149; Antisense; AATCGGTTTCGTGGATGTCTATCGC
>probe:Drosophila_2:1624539_at:476:61; Interrogation_Position=3163; Antisense; ATGTCTATCGCGAGGAGGCCACCAA
>probe:Drosophila_2:1624539_at:259:483; Interrogation_Position=3188; Antisense; GTGTATTTACATGGGTCGCCGTTTC
>probe:Drosophila_2:1624539_at:389:625; Interrogation_Position=3238; Antisense; TGCCTCCACTTTTAATGTTCCTTCA
>probe:Drosophila_2:1624539_at:18:647; Interrogation_Position=3260; Antisense; TCATCTTTGGTATTCCGGCTAGCGG
>probe:Drosophila_2:1624539_at:616:121; Interrogation_Position=3280; Antisense; AGCGGTGCTAGCTACTCACGTCATG
>probe:Drosophila_2:1624539_at:681:645; Interrogation_Position=3300; Antisense; TCATGTCCTCGTCCTTTTTGTATTC
>probe:Drosophila_2:1624539_at:702:689; Interrogation_Position=3340; Antisense; TTTGTATAACTGACCAACCCTTCCA
>probe:Drosophila_2:1624539_at:147:201; Interrogation_Position=3355; Antisense; AACCCTTCCAGCATTTATCGTAAGC

Paste this into a BLAST search page for me
GAGGAGGTTGTACAGCTCGTCACCTTTGATCTCCGGAACTTTGCGCGAAGGTGCGAACGGCTGCTTTGGTGCTCAGTTCGCGTTCCGCAACAAGATGTCGGATGTCGCCCAGGTGAACTTTTATTAATCGGTTTCGTGGATGTCTATCGCATGTCTATCGCGAGGAGGCCACCAAGTGTATTTACATGGGTCGCCGTTTCTGCCTCCACTTTTAATGTTCCTTCATCATCTTTGGTATTCCGGCTAGCGGAGCGGTGCTAGCTACTCACGTCATGTCATGTCCTCGTCCTTTTTGTATTCTTTGTATAACTGACCAACCCTTCCAAACCCTTCCAGCATTTATCGTAAGC

Full Affymetrix probeset data:

Annotations for 1624539_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720