Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624540_at:

>probe:Drosophila_2:1624540_at:555:97; Interrogation_Position=1284; Antisense; AGATGCCTACATCAGGTTTGTATGA
>probe:Drosophila_2:1624540_at:367:645; Interrogation_Position=1295; Antisense; TCAGGTTTGTATGATGTTGATGAAA
>probe:Drosophila_2:1624540_at:607:65; Interrogation_Position=1347; Antisense; ATGGTATATTCTTTCCATTTATATT
>probe:Drosophila_2:1624540_at:543:717; Interrogation_Position=1359; Antisense; TTCCATTTATATTTCGATTCTTCCT
>probe:Drosophila_2:1624540_at:56:705; Interrogation_Position=1365; Antisense; TTATATTTCGATTCTTCCTATGGCA
>probe:Drosophila_2:1624540_at:356:21; Interrogation_Position=1367; Antisense; ATATTTCGATTCTTCCTATGGCATC
>probe:Drosophila_2:1624540_at:360:17; Interrogation_Position=1369; Antisense; ATTTCGATTCTTCCTATGGCATCTG
>probe:Drosophila_2:1624540_at:169:717; Interrogation_Position=1371; Antisense; TTCGATTCTTCCTATGGCATCTGTG
>probe:Drosophila_2:1624540_at:217:463; Interrogation_Position=1374; Antisense; GATTCTTCCTATGGCATCTGTGTGT
>probe:Drosophila_2:1624540_at:674:713; Interrogation_Position=1376; Antisense; TTCTTCCTATGGCATCTGTGTGTAT
>probe:Drosophila_2:1624540_at:555:275; Interrogation_Position=1378; Antisense; CTTCCTATGGCATCTGTGTGTATGT
>probe:Drosophila_2:1624540_at:475:307; Interrogation_Position=1381; Antisense; CCTATGGCATCTGTGTGTATGTATA
>probe:Drosophila_2:1624540_at:54:517; Interrogation_Position=1393; Antisense; GTGTGTATGTATATGGACCAATCTA
>probe:Drosophila_2:1624540_at:525:71; Interrogation_Position=843; Antisense; AGGAAGTGGAACTGACGGAATACGT

Paste this into a BLAST search page for me
AGATGCCTACATCAGGTTTGTATGATCAGGTTTGTATGATGTTGATGAAAATGGTATATTCTTTCCATTTATATTTTCCATTTATATTTCGATTCTTCCTTTATATTTCGATTCTTCCTATGGCAATATTTCGATTCTTCCTATGGCATCATTTCGATTCTTCCTATGGCATCTGTTCGATTCTTCCTATGGCATCTGTGGATTCTTCCTATGGCATCTGTGTGTTTCTTCCTATGGCATCTGTGTGTATCTTCCTATGGCATCTGTGTGTATGTCCTATGGCATCTGTGTGTATGTATAGTGTGTATGTATATGGACCAATCTAAGGAAGTGGAACTGACGGAATACGT

Full Affymetrix probeset data:

Annotations for 1624540_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime