FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624541_at:

>probe:Drosophila_2:1624541_at:260:69; Interrogation_Position=8425; Antisense; ATGGCGTGTTCGAAATTAGGTTTGA
>probe:Drosophila_2:1624541_at:670:173; Interrogation_Position=8455; Antisense; AAAGCGACTATATGTTTACCATGTG
>probe:Drosophila_2:1624541_at:25:25; Interrogation_Position=8464; Antisense; ATATGTTTACCATGTGACGCACGAG
>probe:Drosophila_2:1624541_at:26:411; Interrogation_Position=8479; Antisense; GACGCACGAGAAACGGCATAAATTT
>probe:Drosophila_2:1624541_at:29:487; Interrogation_Position=8618; Antisense; GTAGTTGTATAGTATTCCTCCCATT
>probe:Drosophila_2:1624541_at:9:725; Interrogation_Position=8622; Antisense; TTGTATAGTATTCCTCCCATTTTTT
>probe:Drosophila_2:1624541_at:412:649; Interrogation_Position=8682; Antisense; TCACAATTATGATTTACACCACCCC
>probe:Drosophila_2:1624541_at:259:21; Interrogation_Position=8736; Antisense; ATATTTTGTACGCATTTTGTTTTGT
>probe:Drosophila_2:1624541_at:307:15; Interrogation_Position=8749; Antisense; ATTTTGTTTTGTTACCCGATGGCAG
>probe:Drosophila_2:1624541_at:220:693; Interrogation_Position=8756; Antisense; TTTGTTACCCGATGGCAGAAAATGA
>probe:Drosophila_2:1624541_at:493:481; Interrogation_Position=8809; Antisense; GTATATAGAAAGTACCCAAGCGCGT
>probe:Drosophila_2:1624541_at:17:485; Interrogation_Position=8820; Antisense; GTACCCAAGCGCGTAACGTTGCTAT
>probe:Drosophila_2:1624541_at:208:323; Interrogation_Position=8828; Antisense; GCGCGTAACGTTGCTATATAAATAT
>probe:Drosophila_2:1624541_at:429:519; Interrogation_Position=8984; Antisense; GTGGATTTTCTATAATGCTGACAAC

Paste this into a BLAST search page for me
ATGGCGTGTTCGAAATTAGGTTTGAAAAGCGACTATATGTTTACCATGTGATATGTTTACCATGTGACGCACGAGGACGCACGAGAAACGGCATAAATTTGTAGTTGTATAGTATTCCTCCCATTTTGTATAGTATTCCTCCCATTTTTTTCACAATTATGATTTACACCACCCCATATTTTGTACGCATTTTGTTTTGTATTTTGTTTTGTTACCCGATGGCAGTTTGTTACCCGATGGCAGAAAATGAGTATATAGAAAGTACCCAAGCGCGTGTACCCAAGCGCGTAACGTTGCTATGCGCGTAACGTTGCTATATAAATATGTGGATTTTCTATAATGCTGACAAC

Full Affymetrix probeset data:

Annotations for 1624541_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720