Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624547_s_at:

>probe:Drosophila_2:1624547_s_at:136:355; Interrogation_Position=145; Antisense; GCACCTGCTCCAGATACGTAAGGAA
>probe:Drosophila_2:1624547_s_at:552:201; Interrogation_Position=168; Antisense; AACCGTTATCATGGTGGGATCTCGA
>probe:Drosophila_2:1624547_s_at:156:327; Interrogation_Position=224; Antisense; GCGAGCGCGATTTGGAGCGCTTTTT
>probe:Drosophila_2:1624547_s_at:717:95; Interrogation_Position=239; Antisense; AGCGCTTTTTCAAAGGCTACGGCCG
>probe:Drosophila_2:1624547_s_at:156:157; Interrogation_Position=265; Antisense; ACACGCGACATCCTCATCAAAAATG
>probe:Drosophila_2:1624547_s_at:85:571; Interrogation_Position=289; Antisense; GGCTACGGCTTTGTGGAATTCGAAG
>probe:Drosophila_2:1624547_s_at:124:403; Interrogation_Position=313; Antisense; GACTATCGTGATGCCGACGATGCCG
>probe:Drosophila_2:1624547_s_at:337:409; Interrogation_Position=328; Antisense; GACGATGCCGTCTATGAACTGAATG
>probe:Drosophila_2:1624547_s_at:553:255; Interrogation_Position=354; Antisense; CAAAGAGCTGCTTGGCGAACGTGTG
>probe:Drosophila_2:1624547_s_at:75:379; Interrogation_Position=370; Antisense; GAACGTGTGGTTGTTGAACCCGCCA
>probe:Drosophila_2:1624547_s_at:356:325; Interrogation_Position=419; Antisense; GCGACCGCTACGACGATCGATATGG
>probe:Drosophila_2:1624547_s_at:476:701; Interrogation_Position=495; Antisense; TTATGGCCCACCGTTGCGCACTGAG
>probe:Drosophila_2:1624547_s_at:700:623; Interrogation_Position=509; Antisense; TGCGCACTGAGTACCGACTGATTGT
>probe:Drosophila_2:1624547_s_at:405:5; Interrogation_Position=529; Antisense; ATTGTGGAGAATTTGTCTAGCCGCG

Paste this into a BLAST search page for me
GCACCTGCTCCAGATACGTAAGGAAAACCGTTATCATGGTGGGATCTCGAGCGAGCGCGATTTGGAGCGCTTTTTAGCGCTTTTTCAAAGGCTACGGCCGACACGCGACATCCTCATCAAAAATGGGCTACGGCTTTGTGGAATTCGAAGGACTATCGTGATGCCGACGATGCCGGACGATGCCGTCTATGAACTGAATGCAAAGAGCTGCTTGGCGAACGTGTGGAACGTGTGGTTGTTGAACCCGCCAGCGACCGCTACGACGATCGATATGGTTATGGCCCACCGTTGCGCACTGAGTGCGCACTGAGTACCGACTGATTGTATTGTGGAGAATTTGTCTAGCCGCG

Full Affymetrix probeset data:

Annotations for 1624547_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime