FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624548_at:

>probe:Drosophila_2:1624548_at:254:323; Interrogation_Position=1031; Antisense; GCGAAAACTGCCTGGTGGTGTGCCT
>probe:Drosophila_2:1624548_at:710:727; Interrogation_Position=1064; Antisense; TTGTGTGGAAGACCTGCCAGTGCTC
>probe:Drosophila_2:1624548_at:221:233; Interrogation_Position=1148; Antisense; AATGCTTGGGCAACAATTCCGATAT
>probe:Drosophila_2:1624548_at:360:659; Interrogation_Position=1212; Antisense; TAACGACTCACGACAGGGTCACTTT
>probe:Drosophila_2:1624548_at:622:529; Interrogation_Position=1227; Antisense; GGGTCACTTTTGTGATTGCCCAGAC
>probe:Drosophila_2:1624548_at:260:397; Interrogation_Position=1249; Antisense; GACAATTGCAATTCACGGCTGTACG
>probe:Drosophila_2:1624548_at:158:605; Interrogation_Position=707; Antisense; TGATTAACCAGTTCTATCCCCACAA
>probe:Drosophila_2:1624548_at:40:463; Interrogation_Position=751; Antisense; GATTCGGGCCTGAAGTTCACGATCA
>probe:Drosophila_2:1624548_at:730:453; Interrogation_Position=771; Antisense; GATCAATGCAAGCTACTCCTTTATG
>probe:Drosophila_2:1624548_at:513:25; Interrogation_Position=802; Antisense; ATAGACGCTCTGACTCCATTTGGAA
>probe:Drosophila_2:1624548_at:457:167; Interrogation_Position=866; Antisense; AAATGATGTACCACCTGTACCCGGA
>probe:Drosophila_2:1624548_at:131:423; Interrogation_Position=895; Antisense; GAGAACTTTGTTGCTGTGCATCCGC
>probe:Drosophila_2:1624548_at:233:559; Interrogation_Position=927; Antisense; GGAAACCTCTCCAAATACCTATGAA
>probe:Drosophila_2:1624548_at:482:673; Interrogation_Position=999; Antisense; TACCTTCCAGAACACTTCGTTGACT

Paste this into a BLAST search page for me
GCGAAAACTGCCTGGTGGTGTGCCTTTGTGTGGAAGACCTGCCAGTGCTCAATGCTTGGGCAACAATTCCGATATTAACGACTCACGACAGGGTCACTTTGGGTCACTTTTGTGATTGCCCAGACGACAATTGCAATTCACGGCTGTACGTGATTAACCAGTTCTATCCCCACAAGATTCGGGCCTGAAGTTCACGATCAGATCAATGCAAGCTACTCCTTTATGATAGACGCTCTGACTCCATTTGGAAAAATGATGTACCACCTGTACCCGGAGAGAACTTTGTTGCTGTGCATCCGCGGAAACCTCTCCAAATACCTATGAATACCTTCCAGAACACTTCGTTGACT

Full Affymetrix probeset data:

Annotations for 1624548_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720