FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624549_at:

>probe:Drosophila_2:1624549_at:220:239; Interrogation_Position=8029; Antisense; AATACTCGGGTTCTATGCACCATGT
>probe:Drosophila_2:1624549_at:693:385; Interrogation_Position=8063; Antisense; GAACACATCGACACCTAGTTAGCAT
>probe:Drosophila_2:1624549_at:597:327; Interrogation_Position=8184; Antisense; GCGTCGATCGGATTGAATCTGCCTA
>probe:Drosophila_2:1624549_at:600:237; Interrogation_Position=8199; Antisense; AATCTGCCTAACTGCTGTCTTGCAG
>probe:Drosophila_2:1624549_at:138:83; Interrogation_Position=8222; Antisense; AGGGCTGTAGGCTTCGGTCCAAAAT
>probe:Drosophila_2:1624549_at:723:657; Interrogation_Position=8247; Antisense; TAAGTCTACAGTCTCTGCGATTCCG
>probe:Drosophila_2:1624549_at:61:425; Interrogation_Position=8294; Antisense; GAGAGGCTCAGTCCATAACACTTAA
>probe:Drosophila_2:1624549_at:502:187; Interrogation_Position=8310; Antisense; AACACTTAACGCTTTGTGCACCGTA
>probe:Drosophila_2:1624549_at:586:241; Interrogation_Position=8336; Antisense; AATTTAGTACCCGACATTCCTTGAG
>probe:Drosophila_2:1624549_at:558:9; Interrogation_Position=8351; Antisense; ATTCCTTGAGAGCTAGACGGCACCA
>probe:Drosophila_2:1624549_at:564:249; Interrogation_Position=8374; Antisense; CAGACGTCCCAACTTACCAAATATA
>probe:Drosophila_2:1624549_at:270:307; Interrogation_Position=8459; Antisense; CCTACAGTTTGTAGTCGCGCATGTA
>probe:Drosophila_2:1624549_at:100:363; Interrogation_Position=8486; Antisense; GAATTTCATTCCTCGAACTAACCCA
>probe:Drosophila_2:1624549_at:615:159; Interrogation_Position=8522; Antisense; ACAACATTCGTTATCTCTCTTGATG

Paste this into a BLAST search page for me
AATACTCGGGTTCTATGCACCATGTGAACACATCGACACCTAGTTAGCATGCGTCGATCGGATTGAATCTGCCTAAATCTGCCTAACTGCTGTCTTGCAGAGGGCTGTAGGCTTCGGTCCAAAATTAAGTCTACAGTCTCTGCGATTCCGGAGAGGCTCAGTCCATAACACTTAAAACACTTAACGCTTTGTGCACCGTAAATTTAGTACCCGACATTCCTTGAGATTCCTTGAGAGCTAGACGGCACCACAGACGTCCCAACTTACCAAATATACCTACAGTTTGTAGTCGCGCATGTAGAATTTCATTCCTCGAACTAACCCAACAACATTCGTTATCTCTCTTGATG

Full Affymetrix probeset data:

Annotations for 1624549_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720