FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624550_at:

>probe:Drosophila_2:1624550_at:442:223; Interrogation_Position=396; Antisense; AAGGTCATCTGCACGGGTGCACGAA
>probe:Drosophila_2:1624550_at:572:171; Interrogation_Position=449; Antisense; AAAGTTCGCACGCATCCTGCAGAAG
>probe:Drosophila_2:1624550_at:610:589; Interrogation_Position=475; Antisense; TGGGATTCCCCGTAAAGTTCATGGA
>probe:Drosophila_2:1624550_at:274:335; Interrogation_Position=506; Antisense; GCTGCAGAATATTGTGGCCACCGTT
>probe:Drosophila_2:1624550_at:19:553; Interrogation_Position=554; Antisense; GGAGAACCTCAACCACGTGCACGGG
>probe:Drosophila_2:1624550_at:415:347; Interrogation_Position=572; Antisense; GCACGGGCAGTTTAGTTCCTACGAA
>probe:Drosophila_2:1624550_at:595:379; Interrogation_Position=594; Antisense; GAACCGGAGATGTTTCCAGGCCTAA
>probe:Drosophila_2:1624550_at:184:269; Interrogation_Position=610; Antisense; CAGGCCTAATCTATCGCATGGTCAA
>probe:Drosophila_2:1624550_at:641:683; Interrogation_Position=621; Antisense; TATCGCATGGTCAAGCCGCGCATCG
>probe:Drosophila_2:1624550_at:718:713; Interrogation_Position=646; Antisense; TTCTCCTGATCTTCGTCAACGGAAA
>probe:Drosophila_2:1624550_at:725:15; Interrogation_Position=677; Antisense; ATTTACGGGCGCCAAGTCGCGCAAG
>probe:Drosophila_2:1624550_at:469:401; Interrogation_Position=702; Antisense; GACATTATGGACTGCCTGGAGGCGA
>probe:Drosophila_2:1624550_at:498:575; Interrogation_Position=722; Antisense; GGCGATATCACCTATTTTACTAAGT
>probe:Drosophila_2:1624550_at:530:405; Interrogation_Position=755; Antisense; GACGTAGTTGTTTCTACACATCCAA

Paste this into a BLAST search page for me
AAGGTCATCTGCACGGGTGCACGAAAAAGTTCGCACGCATCCTGCAGAAGTGGGATTCCCCGTAAAGTTCATGGAGCTGCAGAATATTGTGGCCACCGTTGGAGAACCTCAACCACGTGCACGGGGCACGGGCAGTTTAGTTCCTACGAAGAACCGGAGATGTTTCCAGGCCTAACAGGCCTAATCTATCGCATGGTCAATATCGCATGGTCAAGCCGCGCATCGTTCTCCTGATCTTCGTCAACGGAAAATTTACGGGCGCCAAGTCGCGCAAGGACATTATGGACTGCCTGGAGGCGAGGCGATATCACCTATTTTACTAAGTGACGTAGTTGTTTCTACACATCCAA

Full Affymetrix probeset data:

Annotations for 1624550_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720