Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624551_at:

>probe:Drosophila_2:1624551_at:347:587; Interrogation_Position=146; Antisense; TGGATCGTCGTTTAAGCCCGTCAAG
>probe:Drosophila_2:1624551_at:328:125; Interrogation_Position=160; Antisense; AGCCCGTCAAGCGTCTCAATAGAAA
>probe:Drosophila_2:1624551_at:534:59; Interrogation_Position=226; Antisense; ATGTTACTCCCACCAGGCGGATTAA
>probe:Drosophila_2:1624551_at:130:235; Interrogation_Position=24; Antisense; AATCCTGAGTCGCTTCGGTGGACAA
>probe:Drosophila_2:1624551_at:481:199; Interrogation_Position=250; Antisense; AACGAATCAATACTCCGGTGGCTGT
>probe:Drosophila_2:1624551_at:13:523; Interrogation_Position=267; Antisense; GTGGCTGTCGATCCAAGTCCAAGTC
>probe:Drosophila_2:1624551_at:277:419; Interrogation_Position=310; Antisense; GAGCTCGTACCAGTGCGGCATTAAA
>probe:Drosophila_2:1624551_at:641:385; Interrogation_Position=360; Antisense; GAACATCCTGGAAAGCTGCGCGCTG
>probe:Drosophila_2:1624551_at:611:79; Interrogation_Position=385; Antisense; AGGTCGTCTCCATTTGGCGCAAAAT
>probe:Drosophila_2:1624551_at:484:93; Interrogation_Position=491; Antisense; AGTTCCTGTACCCATTTCCAATGAT
>probe:Drosophila_2:1624551_at:447:675; Interrogation_Position=526; Antisense; TAGTTGAAGTTAGCCCACCGATACC
>probe:Drosophila_2:1624551_at:676:421; Interrogation_Position=552; Antisense; GAGAGAAACCCCTCGATTTTTAGAT
>probe:Drosophila_2:1624551_at:500:377; Interrogation_Position=59; Antisense; GAAGCAGCCGATTGTAGAGCACTTA
>probe:Drosophila_2:1624551_at:128:241; Interrogation_Position=594; Antisense; AATAGGGCCTTGCATATGTTTTACT

Paste this into a BLAST search page for me
TGGATCGTCGTTTAAGCCCGTCAAGAGCCCGTCAAGCGTCTCAATAGAAAATGTTACTCCCACCAGGCGGATTAAAATCCTGAGTCGCTTCGGTGGACAAAACGAATCAATACTCCGGTGGCTGTGTGGCTGTCGATCCAAGTCCAAGTCGAGCTCGTACCAGTGCGGCATTAAAGAACATCCTGGAAAGCTGCGCGCTGAGGTCGTCTCCATTTGGCGCAAAATAGTTCCTGTACCCATTTCCAATGATTAGTTGAAGTTAGCCCACCGATACCGAGAGAAACCCCTCGATTTTTAGATGAAGCAGCCGATTGTAGAGCACTTAAATAGGGCCTTGCATATGTTTTACT

Full Affymetrix probeset data:

Annotations for 1624551_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime