FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624552_at:

>probe:Drosophila_2:1624552_at:9:717; Interrogation_Position=1069; Antisense; TTGCTGCTTTAGAGTGCCGAGGCGC
>probe:Drosophila_2:1624552_at:200:71; Interrogation_Position=1088; Antisense; AGGCGCCGACATTGCTCCTTGGTGA
>probe:Drosophila_2:1624552_at:260:237; Interrogation_Position=1140; Antisense; AATCGCTGTGGAACTTGTGGCCGCA
>probe:Drosophila_2:1624552_at:440:659; Interrogation_Position=1185; Antisense; TAACCAGCAGCATCATCTCGCAAAT
>probe:Drosophila_2:1624552_at:644:641; Interrogation_Position=1200; Antisense; TCTCGCAAATTTCGCAAGTATCCTG
>probe:Drosophila_2:1624552_at:660:111; Interrogation_Position=638; Antisense; AGCAGGCTGTGCTTAACACTGTCAT
>probe:Drosophila_2:1624552_at:512:187; Interrogation_Position=652; Antisense; AACACTGTCATGTCATTCGTGACCA
>probe:Drosophila_2:1624552_at:308:415; Interrogation_Position=672; Antisense; GACCAACGAGTTGCGCATGCAGATT
>probe:Drosophila_2:1624552_at:431:95; Interrogation_Position=692; Antisense; AGATTGTGGACTGACCTGCTCTGCG
>probe:Drosophila_2:1624552_at:77:571; Interrogation_Position=756; Antisense; GGCTATCTCAGTCGAAACCTTTGTG
>probe:Drosophila_2:1624552_at:379:611; Interrogation_Position=839; Antisense; TGAACGACGGTGGTAGCGAACTACT
>probe:Drosophila_2:1624552_at:606:87; Interrogation_Position=888; Antisense; AGTCGTCAACGAACGGCTGGTCGAT
>probe:Drosophila_2:1624552_at:143:535; Interrogation_Position=913; Antisense; GGTGCTGATTAGCAGCCCGCAGAAT
>probe:Drosophila_2:1624552_at:46:365; Interrogation_Position=954; Antisense; GAATATCCTCGATCTCGGTTTTCAG

Paste this into a BLAST search page for me
TTGCTGCTTTAGAGTGCCGAGGCGCAGGCGCCGACATTGCTCCTTGGTGAAATCGCTGTGGAACTTGTGGCCGCATAACCAGCAGCATCATCTCGCAAATTCTCGCAAATTTCGCAAGTATCCTGAGCAGGCTGTGCTTAACACTGTCATAACACTGTCATGTCATTCGTGACCAGACCAACGAGTTGCGCATGCAGATTAGATTGTGGACTGACCTGCTCTGCGGGCTATCTCAGTCGAAACCTTTGTGTGAACGACGGTGGTAGCGAACTACTAGTCGTCAACGAACGGCTGGTCGATGGTGCTGATTAGCAGCCCGCAGAATGAATATCCTCGATCTCGGTTTTCAG

Full Affymetrix probeset data:

Annotations for 1624552_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720