Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624554_at:

>probe:Drosophila_2:1624554_at:529:617; Interrogation_Position=1953; Antisense; TGCACGCCTGGGAACTAGTACTAGC
>probe:Drosophila_2:1624554_at:511:393; Interrogation_Position=2025; Antisense; GAAAGTTGTCGCAGAGCTTCCAGCT
>probe:Drosophila_2:1624554_at:722:209; Interrogation_Position=2081; Antisense; AAGCAAAGTTTGCTCAGCGCCGTGG
>probe:Drosophila_2:1624554_at:214:125; Interrogation_Position=2096; Antisense; AGCGCCGTGGGCATGATTCTGGCAA
>probe:Drosophila_2:1624554_at:520:463; Interrogation_Position=2110; Antisense; GATTCTGGCAATGCATCGTCCATAC
>probe:Drosophila_2:1624554_at:533:473; Interrogation_Position=2142; Antisense; GTAACAACGCGCACTTTAAAGCCTT
>probe:Drosophila_2:1624554_at:623:403; Interrogation_Position=2178; Antisense; GACTCAATTCCCATTTGCTGGTGGA
>probe:Drosophila_2:1624554_at:297:519; Interrogation_Position=2198; Antisense; GTGGAGTGGCTGAACCTGATCCTCA
>probe:Drosophila_2:1624554_at:689:605; Interrogation_Position=2214; Antisense; TGATCCTCAGCTGCCATGAACTGGT
>probe:Drosophila_2:1624554_at:2:533; Interrogation_Position=2236; Antisense; GGTGGACACGTACTACTCAGCAGAC
>probe:Drosophila_2:1624554_at:222:447; Interrogation_Position=2306; Antisense; GATGCTCTTTCTCGATTTGACTTCG
>probe:Drosophila_2:1624554_at:708:221; Interrogation_Position=2373; Antisense; AAGGGCGGCTGACTTGTACATTTTT
>probe:Drosophila_2:1624554_at:434:711; Interrogation_Position=2420; Antisense; TTCAATGTCCAACGTATTCTCTCTC
>probe:Drosophila_2:1624554_at:36:483; Interrogation_Position=2433; Antisense; GTATTCTCTCTCTCACTTATGTATA

Paste this into a BLAST search page for me
TGCACGCCTGGGAACTAGTACTAGCGAAAGTTGTCGCAGAGCTTCCAGCTAAGCAAAGTTTGCTCAGCGCCGTGGAGCGCCGTGGGCATGATTCTGGCAAGATTCTGGCAATGCATCGTCCATACGTAACAACGCGCACTTTAAAGCCTTGACTCAATTCCCATTTGCTGGTGGAGTGGAGTGGCTGAACCTGATCCTCATGATCCTCAGCTGCCATGAACTGGTGGTGGACACGTACTACTCAGCAGACGATGCTCTTTCTCGATTTGACTTCGAAGGGCGGCTGACTTGTACATTTTTTTCAATGTCCAACGTATTCTCTCTCGTATTCTCTCTCTCACTTATGTATA

Full Affymetrix probeset data:

Annotations for 1624554_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime