FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624555_at:

>probe:Drosophila_2:1624555_at:659:387; Interrogation_Position=1330; Antisense; GAAAAGCTATCAAGGGCTCTCCGCT
>probe:Drosophila_2:1624555_at:272:569; Interrogation_Position=1344; Antisense; GGCTCTCCGCTACTATTACGATGGG
>probe:Drosophila_2:1624555_at:156:459; Interrogation_Position=1369; Antisense; GATATGATCTCCAAGGTGTCCGGCA
>probe:Drosophila_2:1624555_at:460:79; Interrogation_Position=1382; Antisense; AGGTGTCCGGCAAGCGATTCGCATA
>probe:Drosophila_2:1624555_at:339:369; Interrogation_Position=1449; Antisense; GAATGAGCTATCCACGCTGGTCAGC
>probe:Drosophila_2:1624555_at:511:673; Interrogation_Position=1499; Antisense; TAGCCGCAACGGAAACAATTACAGA
>probe:Drosophila_2:1624555_at:579:211; Interrogation_Position=1523; Antisense; AAGACACGTGACATGGCGAGCTGAA
>probe:Drosophila_2:1624555_at:166:73; Interrogation_Position=1556; Antisense; AGGAACCCGACATACTCTGGAAGTA
>probe:Drosophila_2:1624555_at:224:707; Interrogation_Position=1590; Antisense; TTAGCGTTGGCTGACTTGGTCGGAT
>probe:Drosophila_2:1624555_at:413:407; Interrogation_Position=1615; Antisense; GACGGCGCCTGGTTAATAATACAAA
>probe:Drosophila_2:1624555_at:167:227; Interrogation_Position=1662; Antisense; AAGGCACACGATTTTATTATCCATT
>probe:Drosophila_2:1624555_at:359:15; Interrogation_Position=1677; Antisense; ATTATCCATTTCGTATTCGCTAAGG
>probe:Drosophila_2:1624555_at:526:339; Interrogation_Position=1695; Antisense; GCTAAGGTTTATAATCTCTGTCTAC
>probe:Drosophila_2:1624555_at:320:45; Interrogation_Position=1739; Antisense; ATCGCGTTTATACTGCTAATCATCT

Paste this into a BLAST search page for me
GAAAAGCTATCAAGGGCTCTCCGCTGGCTCTCCGCTACTATTACGATGGGGATATGATCTCCAAGGTGTCCGGCAAGGTGTCCGGCAAGCGATTCGCATAGAATGAGCTATCCACGCTGGTCAGCTAGCCGCAACGGAAACAATTACAGAAAGACACGTGACATGGCGAGCTGAAAGGAACCCGACATACTCTGGAAGTATTAGCGTTGGCTGACTTGGTCGGATGACGGCGCCTGGTTAATAATACAAAAAGGCACACGATTTTATTATCCATTATTATCCATTTCGTATTCGCTAAGGGCTAAGGTTTATAATCTCTGTCTACATCGCGTTTATACTGCTAATCATCT

Full Affymetrix probeset data:

Annotations for 1624555_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720