FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624557_at:

>probe:Drosophila_2:1624557_at:81:81; Interrogation_Position=1022; Antisense; AGGTGAGACTCGATAGCTTCTTTAA
>probe:Drosophila_2:1624557_at:519:411; Interrogation_Position=1160; Antisense; GACCCAAGTAGTTCATTCGTGTGTT
>probe:Drosophila_2:1624557_at:42:481; Interrogation_Position=731; Antisense; GTATTGGACCCAAGCGAGCGATCGA
>probe:Drosophila_2:1624557_at:5:385; Interrogation_Position=754; Antisense; GAACTGATCAACACCTATCGGGATA
>probe:Drosophila_2:1624557_at:374:403; Interrogation_Position=783; Antisense; GACTATTCTGGATAACCTGGACTCT
>probe:Drosophila_2:1624557_at:397:131; Interrogation_Position=817; Antisense; ACCGTGCCCGAGAACTGGAACTACA
>probe:Drosophila_2:1624557_at:10:379; Interrogation_Position=834; Antisense; GAACTACAAGGTGGCGCGGGAACTC
>probe:Drosophila_2:1624557_at:364:525; Interrogation_Position=851; Antisense; GGGAACTCTTCATCGAACCGGAGGT
>probe:Drosophila_2:1624557_at:593:201; Interrogation_Position=866; Antisense; AACCGGAGGTAGCTGATGCCGACTC
>probe:Drosophila_2:1624557_at:608:447; Interrogation_Position=880; Antisense; GATGCCGACTCCATAGATCTCAAAT
>probe:Drosophila_2:1624557_at:234:433; Interrogation_Position=919; Antisense; GAGGAGGGCCTTGTCAAGTTTCTCT
>probe:Drosophila_2:1624557_at:236:331; Interrogation_Position=944; Antisense; GCGGCGACCGGCAGTTCAACGAAGA
>probe:Drosophila_2:1624557_at:3:417; Interrogation_Position=967; Antisense; GAGCGCGTTCGCAACGGTGCCAAAA
>probe:Drosophila_2:1624557_at:403:443; Interrogation_Position=996; Antisense; GATGAAATCCAAGCAGGCCCAGACT

Paste this into a BLAST search page for me
AGGTGAGACTCGATAGCTTCTTTAAGACCCAAGTAGTTCATTCGTGTGTTGTATTGGACCCAAGCGAGCGATCGAGAACTGATCAACACCTATCGGGATAGACTATTCTGGATAACCTGGACTCTACCGTGCCCGAGAACTGGAACTACAGAACTACAAGGTGGCGCGGGAACTCGGGAACTCTTCATCGAACCGGAGGTAACCGGAGGTAGCTGATGCCGACTCGATGCCGACTCCATAGATCTCAAATGAGGAGGGCCTTGTCAAGTTTCTCTGCGGCGACCGGCAGTTCAACGAAGAGAGCGCGTTCGCAACGGTGCCAAAAGATGAAATCCAAGCAGGCCCAGACT

Full Affymetrix probeset data:

Annotations for 1624557_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720