Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624558_at:

>probe:Drosophila_2:1624558_at:408:371; Interrogation_Position=107; Antisense; GAACTTTCGGAGGTCCTTGCTGGGC
>probe:Drosophila_2:1624558_at:471:307; Interrogation_Position=121; Antisense; CCTTGCTGGGCCTGGAGTGGAGAAA
>probe:Drosophila_2:1624558_at:530:81; Interrogation_Position=136; Antisense; AGTGGAGAAAAGTGCCGCCGTCTCT
>probe:Drosophila_2:1624558_at:180:87; Interrogation_Position=146; Antisense; AGTGCCGCCGTCTCTGCATTGAGGA
>probe:Drosophila_2:1624558_at:321:535; Interrogation_Position=15; Antisense; GGTGCAGATGATATTCCTGTTTGCT
>probe:Drosophila_2:1624558_at:491:281; Interrogation_Position=157; Antisense; CTCTGCATTGAGGAGGGACATGTCA
>probe:Drosophila_2:1624558_at:701:519; Interrogation_Position=182; Antisense; GTGGACACTGCAGTGGCGCAATGAA
>probe:Drosophila_2:1624558_at:485:21; Interrogation_Position=25; Antisense; ATATTCCTGTTTGCTATCCTTGCTG
>probe:Drosophila_2:1624558_at:646:479; Interrogation_Position=33; Antisense; GTTTGCTATCCTTGCTGTAATGACC
>probe:Drosophila_2:1624558_at:515:275; Interrogation_Position=43; Antisense; CTTGCTGTAATGACCATTGTCCTAA
>probe:Drosophila_2:1624558_at:617:725; Interrogation_Position=59; Antisense; TTGTCCTAATGGAGGCCAACACTGT
>probe:Drosophila_2:1624558_at:268:579; Interrogation_Position=72; Antisense; GGCCAACACTGTTTTGGCACGTGAT
>probe:Drosophila_2:1624558_at:177:353; Interrogation_Position=88; Antisense; GCACGTGATTGCCTATCTGGAACTT
>probe:Drosophila_2:1624558_at:71:465; Interrogation_Position=94; Antisense; GATTGCCTATCTGGAACTTTCGGAG

Paste this into a BLAST search page for me
GAACTTTCGGAGGTCCTTGCTGGGCCCTTGCTGGGCCTGGAGTGGAGAAAAGTGGAGAAAAGTGCCGCCGTCTCTAGTGCCGCCGTCTCTGCATTGAGGAGGTGCAGATGATATTCCTGTTTGCTCTCTGCATTGAGGAGGGACATGTCAGTGGACACTGCAGTGGCGCAATGAAATATTCCTGTTTGCTATCCTTGCTGGTTTGCTATCCTTGCTGTAATGACCCTTGCTGTAATGACCATTGTCCTAATTGTCCTAATGGAGGCCAACACTGTGGCCAACACTGTTTTGGCACGTGATGCACGTGATTGCCTATCTGGAACTTGATTGCCTATCTGGAACTTTCGGAG

Full Affymetrix probeset data:

Annotations for 1624558_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime