FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624560_at:

>probe:Drosophila_2:1624560_at:379:97; Interrogation_Position=2165; Antisense; AGATGAATCCATCAGGCTCGGCTCT
>probe:Drosophila_2:1624560_at:502:337; Interrogation_Position=2180; Antisense; GCTCGGCTCTTGAAACTGAATTGGC
>probe:Drosophila_2:1624560_at:144:565; Interrogation_Position=2202; Antisense; GGCAACATAAATCTTTTTTCCCATT
>probe:Drosophila_2:1624560_at:225:701; Interrogation_Position=2215; Antisense; TTTTTTCCCATTTTCATGCGCCAAA
>probe:Drosophila_2:1624560_at:270:17; Interrogation_Position=2224; Antisense; ATTTTCATGCGCCAAATGGTCAACA
>probe:Drosophila_2:1624560_at:9:493; Interrogation_Position=2242; Antisense; GTCAACAAAGCTAGTTAGCCAGCAT
>probe:Drosophila_2:1624560_at:23:313; Interrogation_Position=2259; Antisense; GCCAGCATTTTTGTTATTACGCCAG
>probe:Drosophila_2:1624560_at:713:441; Interrogation_Position=2308; Antisense; GATGAACTGTCTCACTAAGTTTTTG
>probe:Drosophila_2:1624560_at:703:655; Interrogation_Position=2323; Antisense; TAAGTTTTTGTTCGGTTCGCATCGT
>probe:Drosophila_2:1624560_at:216:717; Interrogation_Position=2338; Antisense; TTCGCATCGTCACTGGTGCGATGTA
>probe:Drosophila_2:1624560_at:418:285; Interrogation_Position=2350; Antisense; CTGGTGCGATGTAAGGAAGTTTTCT
>probe:Drosophila_2:1624560_at:503:563; Interrogation_Position=2364; Antisense; GGAAGTTTTCTACTGAATAATCTTA
>probe:Drosophila_2:1624560_at:697:685; Interrogation_Position=2438; Antisense; TATATGTTGTCCATTCCAGTCTCGA
>probe:Drosophila_2:1624560_at:457:597; Interrogation_Position=2445; Antisense; TGTCCATTCCAGTCTCGATAGAAAT

Paste this into a BLAST search page for me
AGATGAATCCATCAGGCTCGGCTCTGCTCGGCTCTTGAAACTGAATTGGCGGCAACATAAATCTTTTTTCCCATTTTTTTTCCCATTTTCATGCGCCAAAATTTTCATGCGCCAAATGGTCAACAGTCAACAAAGCTAGTTAGCCAGCATGCCAGCATTTTTGTTATTACGCCAGGATGAACTGTCTCACTAAGTTTTTGTAAGTTTTTGTTCGGTTCGCATCGTTTCGCATCGTCACTGGTGCGATGTACTGGTGCGATGTAAGGAAGTTTTCTGGAAGTTTTCTACTGAATAATCTTATATATGTTGTCCATTCCAGTCTCGATGTCCATTCCAGTCTCGATAGAAAT

Full Affymetrix probeset data:

Annotations for 1624560_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720