Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624563_at:

>probe:Drosophila_2:1624563_at:223:83; Interrogation_Position=1224; Antisense; AGGGCAGGACCCACATAATACACAC
>probe:Drosophila_2:1624563_at:374:549; Interrogation_Position=1273; Antisense; GGAGGACACAGCCAAACTTCACACC
>probe:Drosophila_2:1624563_at:654:579; Interrogation_Position=1347; Antisense; TGGCGAGCAAACTCCACGGGATGAT
>probe:Drosophila_2:1624563_at:395:259; Interrogation_Position=1361; Antisense; CACGGGATGATCTGGACTTGCTAGA
>probe:Drosophila_2:1624563_at:653:437; Interrogation_Position=1456; Antisense; GAGGAAATGTCCAATGAGCCCAATG
>probe:Drosophila_2:1624563_at:511:231; Interrogation_Position=1477; Antisense; AATGACTTGGAGACGGAACCCGAGG
>probe:Drosophila_2:1624563_at:378:547; Interrogation_Position=1500; Antisense; GGATGCGGACTACGGCCTTGAATAT
>probe:Drosophila_2:1624563_at:710:421; Interrogation_Position=1540; Antisense; GAGAATCCCGAATCTCCGAGTGGCG
>probe:Drosophila_2:1624563_at:344:435; Interrogation_Position=1582; Antisense; GAGGATTCAAGCTATATGGTACCAG
>probe:Drosophila_2:1624563_at:214:549; Interrogation_Position=1641; Antisense; GGAGGACCAGATGGACCCAGTGAAT
>probe:Drosophila_2:1624563_at:397:549; Interrogation_Position=1671; Antisense; GGAGGATAACGCACCTATGGATGGA
>probe:Drosophila_2:1624563_at:78:171; Interrogation_Position=1720; Antisense; AAAGGTCCGATTATCCTGTCAATTG
>probe:Drosophila_2:1624563_at:512:249; Interrogation_Position=1739; Antisense; CAATTGGAACTCCTCGAAATCCCTT
>probe:Drosophila_2:1624563_at:320:161; Interrogation_Position=1755; Antisense; AAATCCCTTTCACATTTACGCCTAT

Paste this into a BLAST search page for me
AGGGCAGGACCCACATAATACACACGGAGGACACAGCCAAACTTCACACCTGGCGAGCAAACTCCACGGGATGATCACGGGATGATCTGGACTTGCTAGAGAGGAAATGTCCAATGAGCCCAATGAATGACTTGGAGACGGAACCCGAGGGGATGCGGACTACGGCCTTGAATATGAGAATCCCGAATCTCCGAGTGGCGGAGGATTCAAGCTATATGGTACCAGGGAGGACCAGATGGACCCAGTGAATGGAGGATAACGCACCTATGGATGGAAAAGGTCCGATTATCCTGTCAATTGCAATTGGAACTCCTCGAAATCCCTTAAATCCCTTTCACATTTACGCCTAT

Full Affymetrix probeset data:

Annotations for 1624563_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime