Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624564_s_at:

>probe:Drosophila_2:1624564_s_at:485:501; Interrogation_Position=509; Antisense; GTCGTCGTCTGTAGATGGCAGTATC
>probe:Drosophila_2:1624564_s_at:93:637; Interrogation_Position=513; Antisense; TCGTCTGTAGATGGCAGTATCTGGA
>probe:Drosophila_2:1624564_s_at:649:349; Interrogation_Position=526; Antisense; GCAGTATCTGGAAAGCAGTAGTCTA
>probe:Drosophila_2:1624564_s_at:491:265; Interrogation_Position=541; Antisense; CAGTAGTCTATGTTTGCGGTCGAAA
>probe:Drosophila_2:1624564_s_at:538:673; Interrogation_Position=544; Antisense; TAGTCTATGTTTGCGGTCGAAATAC
>probe:Drosophila_2:1624564_s_at:450:185; Interrogation_Position=55; Antisense; AACAAACCCAGAATGGCACCCAGGA
>probe:Drosophila_2:1624564_s_at:455:329; Interrogation_Position=556; Antisense; GCGGTCGAAATACAATACTGCATTT
>probe:Drosophila_2:1624564_s_at:318:249; Interrogation_Position=568; Antisense; CAATACTGCATTTGTGTATGCGATA
>probe:Drosophila_2:1624564_s_at:411:15; Interrogation_Position=577; Antisense; ATTTGTGTATGCGATAAGAAAGCTT
>probe:Drosophila_2:1624564_s_at:348:209; Interrogation_Position=592; Antisense; AAGAAAGCTTTTCTGTTCGTGTGCA
>probe:Drosophila_2:1624564_s_at:560:601; Interrogation_Position=605; Antisense; TGTTCGTGTGCATAGGTGCACTGTA
>probe:Drosophila_2:1624564_s_at:413:25; Interrogation_Position=616; Antisense; ATAGGTGCACTGTAATAAACCAGGA
>probe:Drosophila_2:1624564_s_at:166:371; Interrogation_Position=65; Antisense; GAATGGCACCCAGGAAGGCTAAAGT
>probe:Drosophila_2:1624564_s_at:543:565; Interrogation_Position=69; Antisense; GGCACCCAGGAAGGCTAAAGTTCAG

Paste this into a BLAST search page for me
GTCGTCGTCTGTAGATGGCAGTATCTCGTCTGTAGATGGCAGTATCTGGAGCAGTATCTGGAAAGCAGTAGTCTACAGTAGTCTATGTTTGCGGTCGAAATAGTCTATGTTTGCGGTCGAAATACAACAAACCCAGAATGGCACCCAGGAGCGGTCGAAATACAATACTGCATTTCAATACTGCATTTGTGTATGCGATAATTTGTGTATGCGATAAGAAAGCTTAAGAAAGCTTTTCTGTTCGTGTGCATGTTCGTGTGCATAGGTGCACTGTAATAGGTGCACTGTAATAAACCAGGAGAATGGCACCCAGGAAGGCTAAAGTGGCACCCAGGAAGGCTAAAGTTCAG

Full Affymetrix probeset data:

Annotations for 1624564_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime