Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624567_at:

>probe:Drosophila_2:1624567_at:388:169; Interrogation_Position=2039; Antisense; AAAGGCACGAGGACGCAAACGCCTC
>probe:Drosophila_2:1624567_at:61:283; Interrogation_Position=2061; Antisense; CTCGCTCGCTAGCTAAGCTACGAAA
>probe:Drosophila_2:1624567_at:506:161; Interrogation_Position=2142; Antisense; AAATTATTGGCTTCCGATCGCGACT
>probe:Drosophila_2:1624567_at:168:281; Interrogation_Position=2165; Antisense; CTCTCCACTTTTAATACTCCCATAG
>probe:Drosophila_2:1624567_at:92:177; Interrogation_Position=2202; Antisense; AAACGAAAGCTCTGATCTGCCGACT
>probe:Drosophila_2:1624567_at:101:453; Interrogation_Position=2215; Antisense; GATCTGCCGACTATCAATCGCGAAA
>probe:Drosophila_2:1624567_at:348:445; Interrogation_Position=2281; Antisense; GATGCTTTTAAACATTTCGTTGCTC
>probe:Drosophila_2:1624567_at:144:279; Interrogation_Position=2303; Antisense; CTCTCGGAAACTGCCTTACTTGTTA
>probe:Drosophila_2:1624567_at:373:693; Interrogation_Position=2336; Antisense; TTTGATATTATTGCCGCCATTCCGT
>probe:Drosophila_2:1624567_at:268:319; Interrogation_Position=2348; Antisense; GCCGCCATTCCGTGATTGATTTAAC
>probe:Drosophila_2:1624567_at:324:647; Interrogation_Position=2391; Antisense; TCAGGGACTGTTTCCAATTCTTTTG
>probe:Drosophila_2:1624567_at:255:245; Interrogation_Position=2406; Antisense; AATTCTTTTGGATGTGCTTGCTTAA
>probe:Drosophila_2:1624567_at:459:195; Interrogation_Position=2445; Antisense; AACTGTCAGCCAATATGATTTCCAA
>probe:Drosophila_2:1624567_at:547:525; Interrogation_Position=2527; Antisense; GGGAACCAATACTCCAATTCTCTGA

Paste this into a BLAST search page for me
AAAGGCACGAGGACGCAAACGCCTCCTCGCTCGCTAGCTAAGCTACGAAAAAATTATTGGCTTCCGATCGCGACTCTCTCCACTTTTAATACTCCCATAGAAACGAAAGCTCTGATCTGCCGACTGATCTGCCGACTATCAATCGCGAAAGATGCTTTTAAACATTTCGTTGCTCCTCTCGGAAACTGCCTTACTTGTTATTTGATATTATTGCCGCCATTCCGTGCCGCCATTCCGTGATTGATTTAACTCAGGGACTGTTTCCAATTCTTTTGAATTCTTTTGGATGTGCTTGCTTAAAACTGTCAGCCAATATGATTTCCAAGGGAACCAATACTCCAATTCTCTGA

Full Affymetrix probeset data:

Annotations for 1624567_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime