Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624568_at:

>probe:Drosophila_2:1624568_at:530:685; Interrogation_Position=2085; Antisense; TATACGACGAGTACACGGTGACGGA
>probe:Drosophila_2:1624568_at:109:267; Interrogation_Position=2164; Antisense; CAGGGCGGAAATGCTGCTCCAGCGA
>probe:Drosophila_2:1624568_at:208:627; Interrogation_Position=2211; Antisense; TGCCTCTGCCCTTGAAAGTGCAGGA
>probe:Drosophila_2:1624568_at:147:75; Interrogation_Position=2235; Antisense; AGGACATGGGACTGGTGACGCATCA
>probe:Drosophila_2:1624568_at:718:439; Interrogation_Position=2276; Antisense; GAGGCGCCAGCCAAAATCTGACAAT
>probe:Drosophila_2:1624568_at:141:185; Interrogation_Position=2288; Antisense; AAAATCTGACAATTGGCCTCGGGCC
>probe:Drosophila_2:1624568_at:463:581; Interrogation_Position=2301; Antisense; TGGCCTCGGGCCAAATATGAGTTAC
>probe:Drosophila_2:1624568_at:237:405; Interrogation_Position=2338; Antisense; GACTAATCGCCAACTGGCTGGCAGT
>probe:Drosophila_2:1624568_at:518:281; Interrogation_Position=2368; Antisense; CTCCGGATCTTAATCTACTCGCATA
>probe:Drosophila_2:1624568_at:662:321; Interrogation_Position=2416; Antisense; GCCCAGCATCTTGTGGCTTATAAGC
>probe:Drosophila_2:1624568_at:606:569; Interrogation_Position=2471; Antisense; GGCTTCTCGGCCCAAAATACATACA
>probe:Drosophila_2:1624568_at:224:539; Interrogation_Position=2500; Antisense; GGTAGCATTAGCCACTTGTAATACT
>probe:Drosophila_2:1624568_at:630:403; Interrogation_Position=2552; Antisense; GACTACTTTGTAAGCAGCGGCTCAA
>probe:Drosophila_2:1624568_at:362:353; Interrogation_Position=2565; Antisense; GCAGCGGCTCAATTATACAAACATA

Paste this into a BLAST search page for me
TATACGACGAGTACACGGTGACGGACAGGGCGGAAATGCTGCTCCAGCGATGCCTCTGCCCTTGAAAGTGCAGGAAGGACATGGGACTGGTGACGCATCAGAGGCGCCAGCCAAAATCTGACAATAAAATCTGACAATTGGCCTCGGGCCTGGCCTCGGGCCAAATATGAGTTACGACTAATCGCCAACTGGCTGGCAGTCTCCGGATCTTAATCTACTCGCATAGCCCAGCATCTTGTGGCTTATAAGCGGCTTCTCGGCCCAAAATACATACAGGTAGCATTAGCCACTTGTAATACTGACTACTTTGTAAGCAGCGGCTCAAGCAGCGGCTCAATTATACAAACATA

Full Affymetrix probeset data:

Annotations for 1624568_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime