FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624569_at:

>probe:Drosophila_2:1624569_at:360:723; Interrogation_Position=1036; Antisense; TTGAAGAACCTGCATGCTTCCCTTT
>probe:Drosophila_2:1624569_at:199:481; Interrogation_Position=1070; Antisense; GTTTGGCTGCTTATATGGTGGTCTC
>probe:Drosophila_2:1624569_at:134:65; Interrogation_Position=1084; Antisense; ATGGTGGTCTCCAAGGTGTTGCCCG
>probe:Drosophila_2:1624569_at:610:721; Interrogation_Position=1102; Antisense; TTGCCCGTCGTCATGCTGGACAAGA
>probe:Drosophila_2:1624569_at:66:341; Interrogation_Position=1180; Antisense; GCTATGTTCACCAACCCGAAGTATG
>probe:Drosophila_2:1624569_at:49:435; Interrogation_Position=1219; Antisense; GAGGTGCTGCCATGGTTGGACAACC
>probe:Drosophila_2:1624569_at:655:579; Interrogation_Position=710; Antisense; TGGCTGACAGCGATGACTACTTGGT
>probe:Drosophila_2:1624569_at:427:147; Interrogation_Position=725; Antisense; ACTACTTGGTGGATCGTCTGCTGCA
>probe:Drosophila_2:1624569_at:557:109; Interrogation_Position=771; Antisense; AGAATTCAACGTGCTCAACCATGGA
>probe:Drosophila_2:1624569_at:304:203; Interrogation_Position=787; Antisense; AACCATGGAGACTGCTGGGCCAATA
>probe:Drosophila_2:1624569_at:346:423; Interrogation_Position=850; Antisense; GAGACCCTTTTCGTTGACTTTCAAG
>probe:Drosophila_2:1624569_at:521:373; Interrogation_Position=887; Antisense; GAAGTCCGGCCAATGATCTGTACTA
>probe:Drosophila_2:1624569_at:187:711; Interrogation_Position=913; Antisense; TTAATATTGTCATCGGCTGCTCCAG
>probe:Drosophila_2:1624569_at:281:479; Interrogation_Position=954; Antisense; GTTTGACTACTTGGTGCGCTACTAT

Paste this into a BLAST search page for me
TTGAAGAACCTGCATGCTTCCCTTTGTTTGGCTGCTTATATGGTGGTCTCATGGTGGTCTCCAAGGTGTTGCCCGTTGCCCGTCGTCATGCTGGACAAGAGCTATGTTCACCAACCCGAAGTATGGAGGTGCTGCCATGGTTGGACAACCTGGCTGACAGCGATGACTACTTGGTACTACTTGGTGGATCGTCTGCTGCAAGAATTCAACGTGCTCAACCATGGAAACCATGGAGACTGCTGGGCCAATAGAGACCCTTTTCGTTGACTTTCAAGGAAGTCCGGCCAATGATCTGTACTATTAATATTGTCATCGGCTGCTCCAGGTTTGACTACTTGGTGCGCTACTAT

Full Affymetrix probeset data:

Annotations for 1624569_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720