Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624571_s_at:

>probe:Drosophila_2:1624571_s_at:427:317; Interrogation_Position=351; Antisense; GCCCACAACAGTCCTTTGGCCAAAT
>probe:Drosophila_2:1624571_s_at:147:581; Interrogation_Position=367; Antisense; TGGCCAAATTGCTGTTCCGCGTGGA
>probe:Drosophila_2:1624571_s_at:283:709; Interrogation_Position=397; Antisense; TTAAGGGCGTGTTCTTTGGCGCCGA
>probe:Drosophila_2:1624571_s_at:69:715; Interrogation_Position=423; Antisense; TTCGTCACCATCTCGAAGCAGGAGG
>probe:Drosophila_2:1624571_s_at:218:323; Interrogation_Position=448; Antisense; GCGCCGAGTGGAGCCTGATTAAGCC
>probe:Drosophila_2:1624571_s_at:118:205; Interrogation_Position=468; Antisense; AAGCCAGAGGTGTTTGCCGTCATAA
>probe:Drosophila_2:1624571_s_at:525:31; Interrogation_Position=489; Antisense; ATAATGGACTTCTTTGCCAGCGGCT
>probe:Drosophila_2:1624571_s_at:378:121; Interrogation_Position=507; Antisense; AGCGGCTTACCAGTTCTCAACGATG
>probe:Drosophila_2:1624571_s_at:608:233; Interrogation_Position=540; Antisense; AATGCGGACACCGAGATCCTCGAGG
>probe:Drosophila_2:1624571_s_at:496:325; Interrogation_Position=640; Antisense; GCGACATCGTCTTCATGGGCTACGA
>probe:Drosophila_2:1624571_s_at:80:339; Interrogation_Position=680; Antisense; GCTAAAGATGCAAGGCTCCTGCTCC
>probe:Drosophila_2:1624571_s_at:326:503; Interrogation_Position=709; Antisense; GTCCCAGCTCCATTGTGACGCTGAA
>probe:Drosophila_2:1624571_s_at:473:619; Interrogation_Position=751; Antisense; TGCTGCAATTCTACATACCGGAGGT
>probe:Drosophila_2:1624571_s_at:31:589; Interrogation_Position=775; Antisense; TGGAGTCCGTTGAGCAGGTCTTCGA

Paste this into a BLAST search page for me
GCCCACAACAGTCCTTTGGCCAAATTGGCCAAATTGCTGTTCCGCGTGGATTAAGGGCGTGTTCTTTGGCGCCGATTCGTCACCATCTCGAAGCAGGAGGGCGCCGAGTGGAGCCTGATTAAGCCAAGCCAGAGGTGTTTGCCGTCATAAATAATGGACTTCTTTGCCAGCGGCTAGCGGCTTACCAGTTCTCAACGATGAATGCGGACACCGAGATCCTCGAGGGCGACATCGTCTTCATGGGCTACGAGCTAAAGATGCAAGGCTCCTGCTCCGTCCCAGCTCCATTGTGACGCTGAATGCTGCAATTCTACATACCGGAGGTTGGAGTCCGTTGAGCAGGTCTTCGA

Full Affymetrix probeset data:

Annotations for 1624571_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime