Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624572_a_at:

>probe:Drosophila_2:1624572_a_at:634:61; Interrogation_Position=204; Antisense; ATGTCCGCCGCAAGAAGACTATGCC
>probe:Drosophila_2:1624572_a_at:79:405; Interrogation_Position=220; Antisense; GACTATGCCCAATTATTTGCACAGT
>probe:Drosophila_2:1624572_a_at:479:595; Interrogation_Position=256; Antisense; TGTGCTAAAGACATCGACACCTTAA
>probe:Drosophila_2:1624572_a_at:672:399; Interrogation_Position=271; Antisense; GACACCTTAATCGAGTCTCTTCCAA
>probe:Drosophila_2:1624572_a_at:676:211; Interrogation_Position=299; Antisense; AAGACAGCTCCATTGAACTCCAAAA
>probe:Drosophila_2:1624572_a_at:313:381; Interrogation_Position=313; Antisense; GAACTCCAAAATTCTAGCCTTAAGA
>probe:Drosophila_2:1624572_a_at:255:329; Interrogation_Position=339; Antisense; GCTCGAGATCGAAAACCAGGGAACT
>probe:Drosophila_2:1624572_a_at:427:233; Interrogation_Position=431; Antisense; AATGCATTGCTCAGGCTCAATTAGA
>probe:Drosophila_2:1624572_a_at:617:249; Interrogation_Position=484; Antisense; CAATAGCTGCTTAACACATTTTTGT
>probe:Drosophila_2:1624572_a_at:681:5; Interrogation_Position=548; Antisense; ATTGCATTTTCGTTCGTGTTTACAG
>probe:Drosophila_2:1624572_a_at:526:175; Interrogation_Position=639; Antisense; AAACCATTTTGAACAGCACCTCTGA
>probe:Drosophila_2:1624572_a_at:356:307; Interrogation_Position=657; Antisense; CCTCTGACCTCGTTGATATAATTTT
>probe:Drosophila_2:1624572_a_at:196:1; Interrogation_Position=721; Antisense; ATATATACTTACACGTACCCCACTT
>probe:Drosophila_2:1624572_a_at:69:259; Interrogation_Position=732; Antisense; CACGTACCCCACTTTGGATTTTATG

Paste this into a BLAST search page for me
ATGTCCGCCGCAAGAAGACTATGCCGACTATGCCCAATTATTTGCACAGTTGTGCTAAAGACATCGACACCTTAAGACACCTTAATCGAGTCTCTTCCAAAAGACAGCTCCATTGAACTCCAAAAGAACTCCAAAATTCTAGCCTTAAGAGCTCGAGATCGAAAACCAGGGAACTAATGCATTGCTCAGGCTCAATTAGACAATAGCTGCTTAACACATTTTTGTATTGCATTTTCGTTCGTGTTTACAGAAACCATTTTGAACAGCACCTCTGACCTCTGACCTCGTTGATATAATTTTATATATACTTACACGTACCCCACTTCACGTACCCCACTTTGGATTTTATG

Full Affymetrix probeset data:

Annotations for 1624572_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime