FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624573_at:

>probe:Drosophila_2:1624573_at:367:53; Interrogation_Position=2759; Antisense; ATGTGGTCAGGTGAACGTTCCCGGC
>probe:Drosophila_2:1624573_at:208:449; Interrogation_Position=2816; Antisense; GATCCAACAGATCACCCAGAGCTAT
>probe:Drosophila_2:1624573_at:463:435; Interrogation_Position=2874; Antisense; GAGGTGACTGGCTACCATGCGAATA
>probe:Drosophila_2:1624573_at:334:51; Interrogation_Position=2890; Antisense; ATGCGAATATCACCGGATCCGTTCC
>probe:Drosophila_2:1624573_at:719:443; Interrogation_Position=2931; Antisense; GATGAGTTCGTTTTCCACTTCTGAC
>probe:Drosophila_2:1624573_at:66:457; Interrogation_Position=3007; Antisense; GATAGTGGCATTCGTCATCGTATTT
>probe:Drosophila_2:1624573_at:115:497; Interrogation_Position=3020; Antisense; GTCATCGTATTTATCACTCTTAGTT
>probe:Drosophila_2:1624573_at:256:547; Interrogation_Position=3050; Antisense; GGATGTCTCCTTGAATACCTGTTAT
>probe:Drosophila_2:1624573_at:69:23; Interrogation_Position=3085; Antisense; ATATATGATTCACTTCCCTTCACTT
>probe:Drosophila_2:1624573_at:477:603; Interrogation_Position=3114; Antisense; TGTTGACCCACTCATTAGCTACTCA
>probe:Drosophila_2:1624573_at:152:341; Interrogation_Position=3131; Antisense; GCTACTCACAGTTGTTGCTCAATTG
>probe:Drosophila_2:1624573_at:702:495; Interrogation_Position=3174; Antisense; GTCACCTTGTCACTTCTTTGATATT
>probe:Drosophila_2:1624573_at:704:491; Interrogation_Position=3203; Antisense; GTAACGCGAATCTTGTACACCGAGT
>probe:Drosophila_2:1624573_at:121:259; Interrogation_Position=3220; Antisense; CACCGAGTTCCGATTTTGTCTTGTA

Paste this into a BLAST search page for me
ATGTGGTCAGGTGAACGTTCCCGGCGATCCAACAGATCACCCAGAGCTATGAGGTGACTGGCTACCATGCGAATAATGCGAATATCACCGGATCCGTTCCGATGAGTTCGTTTTCCACTTCTGACGATAGTGGCATTCGTCATCGTATTTGTCATCGTATTTATCACTCTTAGTTGGATGTCTCCTTGAATACCTGTTATATATATGATTCACTTCCCTTCACTTTGTTGACCCACTCATTAGCTACTCAGCTACTCACAGTTGTTGCTCAATTGGTCACCTTGTCACTTCTTTGATATTGTAACGCGAATCTTGTACACCGAGTCACCGAGTTCCGATTTTGTCTTGTA

Full Affymetrix probeset data:

Annotations for 1624573_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720