FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624574_at:

>probe:Drosophila_2:1624574_at:402:119; Interrogation_Position=2220; Antisense; AGCGGCTACGTTTGTGCCTCCGCAG
>probe:Drosophila_2:1624574_at:459:541; Interrogation_Position=2253; Antisense; GGTTGTCTACAACCCACAACAGCAG
>probe:Drosophila_2:1624574_at:268:145; Interrogation_Position=2289; Antisense; ACTGCGACGCAGTTCACGTGGCAAG
>probe:Drosophila_2:1624574_at:162:93; Interrogation_Position=2299; Antisense; AGTTCACGTGGCAAGACGGGTTCTT
>probe:Drosophila_2:1624574_at:9:715; Interrogation_Position=2319; Antisense; TTCTTGTGTGAGTTCGGCAGCGGCA
>probe:Drosophila_2:1624574_at:637:131; Interrogation_Position=2418; Antisense; ACCGCCTGGTACCTATCAATACCAA
>probe:Drosophila_2:1624574_at:430:241; Interrogation_Position=2455; Antisense; AATACCGTTGTAGTTGCCGTGCGTC
>probe:Drosophila_2:1624574_at:173:625; Interrogation_Position=2469; Antisense; TGCCGTGCGTCATCAGCAACAGTTG
>probe:Drosophila_2:1624574_at:530:113; Interrogation_Position=2513; Antisense; AGCAGCAACTGGCTTTACATCATCA
>probe:Drosophila_2:1624574_at:332:353; Interrogation_Position=2619; Antisense; GCAGCCAGGATTCTTGTTCAGCTAT
>probe:Drosophila_2:1624574_at:547:123; Interrogation_Position=2676; Antisense; AGCGCAGCAAATACATCAGGGCCCC
>probe:Drosophila_2:1624574_at:445:35; Interrogation_Position=2690; Antisense; ATCAGGGCCCCAAAGTGACGCATAG
>probe:Drosophila_2:1624574_at:449:351; Interrogation_Position=2778; Antisense; GCAAATCAAAATCCAGGGTCTCCTC
>probe:Drosophila_2:1624574_at:398:531; Interrogation_Position=2793; Antisense; GGGTCTCCTCAATCATTTTCCATAA

Paste this into a BLAST search page for me
AGCGGCTACGTTTGTGCCTCCGCAGGGTTGTCTACAACCCACAACAGCAGACTGCGACGCAGTTCACGTGGCAAGAGTTCACGTGGCAAGACGGGTTCTTTTCTTGTGTGAGTTCGGCAGCGGCAACCGCCTGGTACCTATCAATACCAAAATACCGTTGTAGTTGCCGTGCGTCTGCCGTGCGTCATCAGCAACAGTTGAGCAGCAACTGGCTTTACATCATCAGCAGCCAGGATTCTTGTTCAGCTATAGCGCAGCAAATACATCAGGGCCCCATCAGGGCCCCAAAGTGACGCATAGGCAAATCAAAATCCAGGGTCTCCTCGGGTCTCCTCAATCATTTTCCATAA

Full Affymetrix probeset data:

Annotations for 1624574_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720