FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624576_at:

>probe:Drosophila_2:1624576_at:721:39; Interrogation_Position=112; Antisense; ATCGGCATGGGCGTGACCATAGTGC
>probe:Drosophila_2:1624576_at:247:595; Interrogation_Position=119; Antisense; TGGGCGTGACCATAGTGCTCCTGAT
>probe:Drosophila_2:1624576_at:715:609; Interrogation_Position=125; Antisense; TGACCATAGTGCTCCTGATCACGAT
>probe:Drosophila_2:1624576_at:52:25; Interrogation_Position=130; Antisense; ATAGTGCTCCTGATCACGATCGCCT
>probe:Drosophila_2:1624576_at:74:35; Interrogation_Position=142; Antisense; ATCACGATCGCCTTGTGCTACATTG
>probe:Drosophila_2:1624576_at:284:275; Interrogation_Position=153; Antisense; CTTGTGCTACATTGCGCGCGAGAAG
>probe:Drosophila_2:1624576_at:662:121; Interrogation_Position=191; Antisense; AGCGGGAGTACTACGTGACCGCATA
>probe:Drosophila_2:1624576_at:562:83; Interrogation_Position=27; Antisense; AGTGGCTGGCAAGGCCGGCTACTCC
>probe:Drosophila_2:1624576_at:31:579; Interrogation_Position=33; Antisense; TGGCAAGGCCGGCTACTCCAATCAC
>probe:Drosophila_2:1624576_at:519:239; Interrogation_Position=52; Antisense; AATCACTACTACAATGGACGCTCCT
>probe:Drosophila_2:1624576_at:279:229; Interrogation_Position=64; Antisense; AATGGACGCTCCTATGTGGGCATCA
>probe:Drosophila_2:1624576_at:81:411; Interrogation_Position=68; Antisense; GACGCTCCTATGTGGGCATCAACGA
>probe:Drosophila_2:1624576_at:530:63; Interrogation_Position=77; Antisense; ATGTGGGCATCAACGAGGAGATCAT
>probe:Drosophila_2:1624576_at:190:97; Interrogation_Position=95; Antisense; AGATCATGTGGGTAAGCATCGGCAT

Paste this into a BLAST search page for me
ATCGGCATGGGCGTGACCATAGTGCTGGGCGTGACCATAGTGCTCCTGATTGACCATAGTGCTCCTGATCACGATATAGTGCTCCTGATCACGATCGCCTATCACGATCGCCTTGTGCTACATTGCTTGTGCTACATTGCGCGCGAGAAGAGCGGGAGTACTACGTGACCGCATAAGTGGCTGGCAAGGCCGGCTACTCCTGGCAAGGCCGGCTACTCCAATCACAATCACTACTACAATGGACGCTCCTAATGGACGCTCCTATGTGGGCATCAGACGCTCCTATGTGGGCATCAACGAATGTGGGCATCAACGAGGAGATCATAGATCATGTGGGTAAGCATCGGCAT

Full Affymetrix probeset data:

Annotations for 1624576_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720