Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624577_at:

>probe:Drosophila_2:1624577_at:113:195; Interrogation_Position=3922; Antisense; AACGCGGACTAATAGCCCCAAGCCA
>probe:Drosophila_2:1624577_at:253:403; Interrogation_Position=3928; Antisense; GACTAATAGCCCCAAGCCAAGCACT
>probe:Drosophila_2:1624577_at:276:127; Interrogation_Position=3942; Antisense; AGCCAAGCACTACCCAAGACAAATT
>probe:Drosophila_2:1624577_at:222:237; Interrogation_Position=4000; Antisense; AATCGATCGAAAATGTGTTGTAAGC
>probe:Drosophila_2:1624577_at:223:149; Interrogation_Position=4010; Antisense; AAATGTGTTGTAAGCGTAGTACGGG
>probe:Drosophila_2:1624577_at:125:665; Interrogation_Position=4182; Antisense; TACACATAGCGAAATTGGATCAATG
>probe:Drosophila_2:1624577_at:180:199; Interrogation_Position=4236; Antisense; AACGTATATGTACTTGGTATGTCTA
>probe:Drosophila_2:1624577_at:175:393; Interrogation_Position=4304; Antisense; GAAAGATCATTGTCAACCCTAGAGT
>probe:Drosophila_2:1624577_at:509:131; Interrogation_Position=4319; Antisense; ACCCTAGAGTTCAGTGTGTGTCGCA
>probe:Drosophila_2:1624577_at:338:429; Interrogation_Position=4325; Antisense; GAGTTCAGTGTGTGTCGCAGACTAA
>probe:Drosophila_2:1624577_at:122:517; Interrogation_Position=4336; Antisense; GTGTCGCAGACTAAATGAGAGCTAA
>probe:Drosophila_2:1624577_at:525:493; Interrogation_Position=4408; Antisense; GTAATCGTAACCGTACTCTGTAATC
>probe:Drosophila_2:1624577_at:90:467; Interrogation_Position=4414; Antisense; GTAACCGTACTCTGTAATCGTATTA
>probe:Drosophila_2:1624577_at:251:493; Interrogation_Position=4427; Antisense; GTAATCGTATTAAAGGCATATCAAT

Paste this into a BLAST search page for me
AACGCGGACTAATAGCCCCAAGCCAGACTAATAGCCCCAAGCCAAGCACTAGCCAAGCACTACCCAAGACAAATTAATCGATCGAAAATGTGTTGTAAGCAAATGTGTTGTAAGCGTAGTACGGGTACACATAGCGAAATTGGATCAATGAACGTATATGTACTTGGTATGTCTAGAAAGATCATTGTCAACCCTAGAGTACCCTAGAGTTCAGTGTGTGTCGCAGAGTTCAGTGTGTGTCGCAGACTAAGTGTCGCAGACTAAATGAGAGCTAAGTAATCGTAACCGTACTCTGTAATCGTAACCGTACTCTGTAATCGTATTAGTAATCGTATTAAAGGCATATCAAT

Full Affymetrix probeset data:

Annotations for 1624577_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime