FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624578_at:

>probe:Drosophila_2:1624578_at:42:701; Interrogation_Position=1019; Antisense; TTTATAGCCCAGAACTCGAGTCATC
>probe:Drosophila_2:1624578_at:415:497; Interrogation_Position=1038; Antisense; GTCATCGATAAAGCATTCCGGTTTT
>probe:Drosophila_2:1624578_at:706:677; Interrogation_Position=1062; Antisense; TAGGGTCAATTTAGGCAAGCTTTAC
>probe:Drosophila_2:1624578_at:277:353; Interrogation_Position=1076; Antisense; GCAAGCTTTACGTAATTTGGGCCTA
>probe:Drosophila_2:1624578_at:110:167; Interrogation_Position=1161; Antisense; AAATGCCTTCTTTTGCTGTTCGAAA
>probe:Drosophila_2:1624578_at:401:573; Interrogation_Position=687; Antisense; GGCGGTGGTGCCATCTATGGCAACA
>probe:Drosophila_2:1624578_at:19:585; Interrogation_Position=704; Antisense; TGGCAACACGTTGATCGGGCTGACC
>probe:Drosophila_2:1624578_at:165:709; Interrogation_Position=714; Antisense; TTGATCGGGCTGACCAACTTTGTGG
>probe:Drosophila_2:1624578_at:701:681; Interrogation_Position=759; Antisense; TATCCGGATGTCTTTGTCCGACTCT
>probe:Drosophila_2:1624578_at:44:405; Interrogation_Position=778; Antisense; GACTCTCCAGCTACGCGGATTGGAT
>probe:Drosophila_2:1624578_at:17:421; Interrogation_Position=807; Antisense; GAGCAGATCGCCTAGATCCGTTTCA
>probe:Drosophila_2:1624578_at:605:697; Interrogation_Position=827; Antisense; TTTCATCCCGTTTTTCCTTCACAAG
>probe:Drosophila_2:1624578_at:143:77; Interrogation_Position=926; Antisense; AGGATCGGTGATTGCCACTGGACTT
>probe:Drosophila_2:1624578_at:446:705; Interrogation_Position=997; Antisense; TTATGACCTCAATGGCATGGCTTTT

Paste this into a BLAST search page for me
TTTATAGCCCAGAACTCGAGTCATCGTCATCGATAAAGCATTCCGGTTTTTAGGGTCAATTTAGGCAAGCTTTACGCAAGCTTTACGTAATTTGGGCCTAAAATGCCTTCTTTTGCTGTTCGAAAGGCGGTGGTGCCATCTATGGCAACATGGCAACACGTTGATCGGGCTGACCTTGATCGGGCTGACCAACTTTGTGGTATCCGGATGTCTTTGTCCGACTCTGACTCTCCAGCTACGCGGATTGGATGAGCAGATCGCCTAGATCCGTTTCATTTCATCCCGTTTTTCCTTCACAAGAGGATCGGTGATTGCCACTGGACTTTTATGACCTCAATGGCATGGCTTTT

Full Affymetrix probeset data:

Annotations for 1624578_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720