Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624579_at:

>probe:Drosophila_2:1624579_at:152:287; Interrogation_Position=107; Antisense; CTGGGCACATCGAGTTTTACAGCGA
>probe:Drosophila_2:1624579_at:591:73; Interrogation_Position=152; Antisense; AGGAAAGGCTCCACTACTCGCATCA
>probe:Drosophila_2:1624579_at:70:141; Interrogation_Position=19; Antisense; ACGTGTCCGGTCAGCATGGCATATG
>probe:Drosophila_2:1624579_at:190:425; Interrogation_Position=221; Antisense; GAGAGCAGCGCCATGGTGACTACGT
>probe:Drosophila_2:1624579_at:494:487; Interrogation_Position=236; Antisense; GTGACTACGTTTCCGGATCGTACTC
>probe:Drosophila_2:1624579_at:532:587; Interrogation_Position=266; Antisense; TGGAGCCCAGTGGACACATTCGCAG
>probe:Drosophila_2:1624579_at:590:149; Interrogation_Position=281; Antisense; ACATTCGCAGTGTGCACTACGAGGT
>probe:Drosophila_2:1624579_at:492:225; Interrogation_Position=328; Antisense; AAGGCCGTTGTTGAGCAGCGAACCG
>probe:Drosophila_2:1624579_at:371:559; Interrogation_Position=353; Antisense; GGAACAGTCGGGTGCACCAGACGCT
>probe:Drosophila_2:1624579_at:379:565; Interrogation_Position=377; Antisense; TGGAATTCCGGAGCAGGCAACCAAT
>probe:Drosophila_2:1624579_at:708:233; Interrogation_Position=399; Antisense; AATCCGGGCTCTGGCAATAGCCGAG
>probe:Drosophila_2:1624579_at:642:295; Interrogation_Position=420; Antisense; CGAGCCTGTGGCATTTGTGATTTAA
>probe:Drosophila_2:1624579_at:505:529; Interrogation_Position=48; Antisense; GGGATTCAGCTTCGTGGTCCTCTGT
>probe:Drosophila_2:1624579_at:402:591; Interrogation_Position=62; Antisense; TGGTCCTCTGTCTGCTGCATATTGC

Paste this into a BLAST search page for me
CTGGGCACATCGAGTTTTACAGCGAAGGAAAGGCTCCACTACTCGCATCAACGTGTCCGGTCAGCATGGCATATGGAGAGCAGCGCCATGGTGACTACGTGTGACTACGTTTCCGGATCGTACTCTGGAGCCCAGTGGACACATTCGCAGACATTCGCAGTGTGCACTACGAGGTAAGGCCGTTGTTGAGCAGCGAACCGGGAACAGTCGGGTGCACCAGACGCTTGGAATTCCGGAGCAGGCAACCAATAATCCGGGCTCTGGCAATAGCCGAGCGAGCCTGTGGCATTTGTGATTTAAGGGATTCAGCTTCGTGGTCCTCTGTTGGTCCTCTGTCTGCTGCATATTGC

Full Affymetrix probeset data:

Annotations for 1624579_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime