Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624580_at:

>probe:Drosophila_2:1624580_at:710:169; Interrogation_Position=367; Antisense; AAAGGTTCCCTCGTTGAAGATTGAT
>probe:Drosophila_2:1624580_at:29:465; Interrogation_Position=385; Antisense; GATTGATGGCCATACCTTGTGCGAC
>probe:Drosophila_2:1624580_at:426:531; Interrogation_Position=412; Antisense; GGTGGCTATTATCCACTACCTGGAG
>probe:Drosophila_2:1624580_at:571:695; Interrogation_Position=459; Antisense; TTCTGCCCCAAGATCCGGTTAAAAG
>probe:Drosophila_2:1624580_at:182:729; Interrogation_Position=501; Antisense; TTGTGGAGCTCATTTGCTCGGGCAT
>probe:Drosophila_2:1624580_at:477:525; Interrogation_Position=520; Antisense; GGGCATCCAGCCACTGCAAAATGTA
>probe:Drosophila_2:1624580_at:482:229; Interrogation_Position=582; Antisense; AATGGGCACAACACTGGATTTCTCG
>probe:Drosophila_2:1624580_at:488:543; Interrogation_Position=597; Antisense; GGATTTCTCGAGGATTTCAGGGTCT
>probe:Drosophila_2:1624580_at:590:273; Interrogation_Position=638; Antisense; CATTCGGCGGGCAAATTCTGTGTGG
>probe:Drosophila_2:1624580_at:239:583; Interrogation_Position=678; Antisense; TGGCTGATATTTGCCTGGTACCTCA
>probe:Drosophila_2:1624580_at:673:427; Interrogation_Position=718; Antisense; GAGATACAAAGCTGACCTGACCCCA
>probe:Drosophila_2:1624580_at:366:21; Interrogation_Position=742; Antisense; ATATCCCACCATAGTACGCTTGAAT
>probe:Drosophila_2:1624580_at:559:95; Interrogation_Position=820; Antisense; AGATTGTCCACCTGAATTCGCAAAA
>probe:Drosophila_2:1624580_at:318:229; Interrogation_Position=900; Antisense; AATGGATTTCCAAAGCACCCAGCAC

Paste this into a BLAST search page for me
AAAGGTTCCCTCGTTGAAGATTGATGATTGATGGCCATACCTTGTGCGACGGTGGCTATTATCCACTACCTGGAGTTCTGCCCCAAGATCCGGTTAAAAGTTGTGGAGCTCATTTGCTCGGGCATGGGCATCCAGCCACTGCAAAATGTAAATGGGCACAACACTGGATTTCTCGGGATTTCTCGAGGATTTCAGGGTCTCATTCGGCGGGCAAATTCTGTGTGGTGGCTGATATTTGCCTGGTACCTCAGAGATACAAAGCTGACCTGACCCCAATATCCCACCATAGTACGCTTGAATAGATTGTCCACCTGAATTCGCAAAAAATGGATTTCCAAAGCACCCAGCAC

Full Affymetrix probeset data:

Annotations for 1624580_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime