FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624581_at:

>probe:Drosophila_2:1624581_at:210:203; Interrogation_Position=132; Antisense; AAGCCTGAACGACCTAACCAATTTG
>probe:Drosophila_2:1624581_at:637:729; Interrogation_Position=154; Antisense; TTGGAGCGACCTTTCTTTGATGATA
>probe:Drosophila_2:1624581_at:139:283; Interrogation_Position=183; Antisense; CCCAAGAAATGTGTCGGCCGTAGTC
>probe:Drosophila_2:1624581_at:334:237; Interrogation_Position=250; Antisense; AATCGCACGGTATCATGGATGCCTG
>probe:Drosophila_2:1624581_at:482:589; Interrogation_Position=265; Antisense; TGGATGCCTGACAACGACTTTCAAG
>probe:Drosophila_2:1624581_at:398:197; Interrogation_Position=368; Antisense; AACGGGATAGCACTATTGCCCTGGC
>probe:Drosophila_2:1624581_at:641:625; Interrogation_Position=384; Antisense; TGCCCTGGCTTGCTCTGTTAATATA
>probe:Drosophila_2:1624581_at:190:69; Interrogation_Position=434; Antisense; ATGGCTCATCAGTTGTTGACTTCGA
>probe:Drosophila_2:1624581_at:216:403; Interrogation_Position=451; Antisense; GACTTCGATTCACTTCGCGGTGGAA
>probe:Drosophila_2:1624581_at:533:445; Interrogation_Position=522; Antisense; GATGCTAACGCGAGCTTCATTAAGG
>probe:Drosophila_2:1624581_at:411:169; Interrogation_Position=573; Antisense; AAATGGAGCCATTCCAGCTTCTGTT
>probe:Drosophila_2:1624581_at:167:309; Interrogation_Position=586; Antisense; CCAGCTTCTGTTAGGGTTCACGTGA
>probe:Drosophila_2:1624581_at:114:187; Interrogation_Position=629; Antisense; AACAAGTTCTGCCATTCGGATTAGG
>probe:Drosophila_2:1624581_at:465:639; Interrogation_Position=644; Antisense; TCGGATTAGGGCTTTCACTGCAATG

Paste this into a BLAST search page for me
AAGCCTGAACGACCTAACCAATTTGTTGGAGCGACCTTTCTTTGATGATACCCAAGAAATGTGTCGGCCGTAGTCAATCGCACGGTATCATGGATGCCTGTGGATGCCTGACAACGACTTTCAAGAACGGGATAGCACTATTGCCCTGGCTGCCCTGGCTTGCTCTGTTAATATAATGGCTCATCAGTTGTTGACTTCGAGACTTCGATTCACTTCGCGGTGGAAGATGCTAACGCGAGCTTCATTAAGGAAATGGAGCCATTCCAGCTTCTGTTCCAGCTTCTGTTAGGGTTCACGTGAAACAAGTTCTGCCATTCGGATTAGGTCGGATTAGGGCTTTCACTGCAATG

Full Affymetrix probeset data:

Annotations for 1624581_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720