FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624583_at:

>probe:Drosophila_2:1624583_at:307:607; Interrogation_Position=118; Antisense; TGATGTCACAGCTGCGCTCGAAAGT
>probe:Drosophila_2:1624583_at:407:89; Interrogation_Position=140; Antisense; AGTCATTAGCCTCTACAAGCACTTG
>probe:Drosophila_2:1624583_at:178:357; Interrogation_Position=158; Antisense; GCACTTGCAGTATTTGGGCCGCGAA
>probe:Drosophila_2:1624583_at:277:197; Interrogation_Position=195; Antisense; AACGGGCCGCAGAAGTTCAGGAAGC
>probe:Drosophila_2:1624583_at:334:115; Interrogation_Position=217; Antisense; AGCAGATCCACGATGCCTTCATGAA
>probe:Drosophila_2:1624583_at:700:543; Interrogation_Position=257; Antisense; GGATCCCAAGAAGATCGTCGCCCTG
>probe:Drosophila_2:1624583_at:396:589; Interrogation_Position=313; Antisense; TGGAGGCCCTGTACTCGCTGAAGAA
>probe:Drosophila_2:1624583_at:537:487; Interrogation_Position=338; Antisense; GTACCGAAGTGTCAAGCAGCGCTAT
>probe:Drosophila_2:1624583_at:150:193; Interrogation_Position=438; Antisense; AACTCAAGGACTGATGCTGTGGATC
>probe:Drosophila_2:1624583_at:387:365; Interrogation_Position=502; Antisense; GAATATGATACGTTTCGCCTTGCTT
>probe:Drosophila_2:1624583_at:113:635; Interrogation_Position=516; Antisense; TCGCCTTGCTTGTCGCACACAAAAA
>probe:Drosophila_2:1624583_at:17:395; Interrogation_Position=562; Antisense; GAAATGCATATTGTTCGGCCAAAAG
>probe:Drosophila_2:1624583_at:409:369; Interrogation_Position=619; Antisense; GAATGTCTTGTCAATGTCCAACTTA
>probe:Drosophila_2:1624583_at:461:663; Interrogation_Position=642; Antisense; TAAAGTTTGTTATTGAGGCACCCAA

Paste this into a BLAST search page for me
TGATGTCACAGCTGCGCTCGAAAGTAGTCATTAGCCTCTACAAGCACTTGGCACTTGCAGTATTTGGGCCGCGAAAACGGGCCGCAGAAGTTCAGGAAGCAGCAGATCCACGATGCCTTCATGAAGGATCCCAAGAAGATCGTCGCCCTGTGGAGGCCCTGTACTCGCTGAAGAAGTACCGAAGTGTCAAGCAGCGCTATAACTCAAGGACTGATGCTGTGGATCGAATATGATACGTTTCGCCTTGCTTTCGCCTTGCTTGTCGCACACAAAAAGAAATGCATATTGTTCGGCCAAAAGGAATGTCTTGTCAATGTCCAACTTATAAAGTTTGTTATTGAGGCACCCAA

Full Affymetrix probeset data:

Annotations for 1624583_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720