FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624584_at:

>probe:Drosophila_2:1624584_at:139:455; Interrogation_Position=108; Antisense; GATCAGCAGTTTTCCCGAAGCCAGT
>probe:Drosophila_2:1624584_at:534:91; Interrogation_Position=130; Antisense; AGTTTCCTGGGTGGCTATGGACTGC
>probe:Drosophila_2:1624584_at:236:619; Interrogation_Position=152; Antisense; TGCAGGATCGCATTGAGGTGCCCAA
>probe:Drosophila_2:1624584_at:522:61; Interrogation_Position=197; Antisense; ATGTCATCGATGAGCGGGACGCGCA
>probe:Drosophila_2:1624584_at:370:149; Interrogation_Position=221; Antisense; ACTTCCTCTACGTAGTCGATAGCCA
>probe:Drosophila_2:1624584_at:691:601; Interrogation_Position=254; Antisense; TGTTGGAGCACATACGTTACTACGG
>probe:Drosophila_2:1624584_at:492:137; Interrogation_Position=281; Antisense; ACGATTACCGGATGGCTTTGCGTGA
>probe:Drosophila_2:1624584_at:466:69; Interrogation_Position=305; Antisense; AGGCCTTCACCACGAAAGTCCTTGA
>probe:Drosophila_2:1624584_at:632:109; Interrogation_Position=335; Antisense; AGAATACTGGCGCAGATCTCCCATT
>probe:Drosophila_2:1624584_at:651:437; Interrogation_Position=382; Antisense; GAGGAACCATGCCAGTGTACACAAC
>probe:Drosophila_2:1624584_at:494:149; Interrogation_Position=434; Antisense; ACTTCATTGCTCGATGGCCGGAAAA
>probe:Drosophila_2:1624584_at:590:665; Interrogation_Position=464; Antisense; TACAAATTCGCTATAATTCCCGCCT
>probe:Drosophila_2:1624584_at:71:301; Interrogation_Position=484; Antisense; CGCCTCGTTGGTTACATGCGAATTT
>probe:Drosophila_2:1624584_at:173:33; Interrogation_Position=88; Antisense; ATCAATGTTTACGTGCCGCCGATCA

Paste this into a BLAST search page for me
GATCAGCAGTTTTCCCGAAGCCAGTAGTTTCCTGGGTGGCTATGGACTGCTGCAGGATCGCATTGAGGTGCCCAAATGTCATCGATGAGCGGGACGCGCAACTTCCTCTACGTAGTCGATAGCCATGTTGGAGCACATACGTTACTACGGACGATTACCGGATGGCTTTGCGTGAAGGCCTTCACCACGAAAGTCCTTGAAGAATACTGGCGCAGATCTCCCATTGAGGAACCATGCCAGTGTACACAACACTTCATTGCTCGATGGCCGGAAAATACAAATTCGCTATAATTCCCGCCTCGCCTCGTTGGTTACATGCGAATTTATCAATGTTTACGTGCCGCCGATCA

Full Affymetrix probeset data:

Annotations for 1624584_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720