FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624587_at:

>probe:Drosophila_2:1624587_at:297:459; Interrogation_Position=14; Antisense; GATATAAAAGCTTGGCCATTCGCAG
>probe:Drosophila_2:1624587_at:60:523; Interrogation_Position=157; Antisense; GGGCGTCGCAATAACAACGACTACC
>probe:Drosophila_2:1624587_at:294:31; Interrogation_Position=167; Antisense; ATAACAACGACTACCTGCTGTCCCG
>probe:Drosophila_2:1624587_at:546:183; Interrogation_Position=19; Antisense; AAAAGCTTGGCCATTCGCAGCAGTT
>probe:Drosophila_2:1624587_at:519:511; Interrogation_Position=235; Antisense; GTGAACGTGAACTATCCCGCCGGAT
>probe:Drosophila_2:1624587_at:10:197; Interrogation_Position=238; Antisense; AACGTGAACTATCCCGCCGGATTCT
>probe:Drosophila_2:1624587_at:557:273; Interrogation_Position=24; Antisense; CTTGGCCATTCGCAGCAGTTACTAT
>probe:Drosophila_2:1624587_at:473:579; Interrogation_Position=27; Antisense; GGCCATTCGCAGCAGTTACTATCAA
>probe:Drosophila_2:1624587_at:79:397; Interrogation_Position=289; Antisense; GACAACTTTAAGAACAACTCCGGCG
>probe:Drosophila_2:1624587_at:204:697; Interrogation_Position=295; Antisense; TTTAAGAACAACTCCGGCGCATCTC
>probe:Drosophila_2:1624587_at:656:295; Interrogation_Position=34; Antisense; CGCAGCAGTTACTATCAAACGATAC
>probe:Drosophila_2:1624587_at:352:235; Interrogation_Position=49; Antisense; CAAACGATACAAGAACGTCGAAACG
>probe:Drosophila_2:1624587_at:300:379; Interrogation_Position=61; Antisense; GAACGTCGAAACGAAACATTCAACA
>probe:Drosophila_2:1624587_at:468:179; Interrogation_Position=74; Antisense; AAACATTCAACATGCGTCTTCTGCT

Paste this into a BLAST search page for me
GATATAAAAGCTTGGCCATTCGCAGGGGCGTCGCAATAACAACGACTACCATAACAACGACTACCTGCTGTCCCGAAAAGCTTGGCCATTCGCAGCAGTTGTGAACGTGAACTATCCCGCCGGATAACGTGAACTATCCCGCCGGATTCTCTTGGCCATTCGCAGCAGTTACTATGGCCATTCGCAGCAGTTACTATCAAGACAACTTTAAGAACAACTCCGGCGTTTAAGAACAACTCCGGCGCATCTCCGCAGCAGTTACTATCAAACGATACCAAACGATACAAGAACGTCGAAACGGAACGTCGAAACGAAACATTCAACAAAACATTCAACATGCGTCTTCTGCT

Full Affymetrix probeset data:

Annotations for 1624587_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720