FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624590_at:

>probe:Drosophila_2:1624590_at:305:243; Interrogation_Position=1005; Antisense; AATATCGGTGGTACTGTCTTCACCC
>probe:Drosophila_2:1624590_at:54:111; Interrogation_Position=1063; Antisense; AGAATGGCCAAACCTACTGCATGTC
>probe:Drosophila_2:1624590_at:119:405; Interrogation_Position=1108; Antisense; GACTAAGCTTCTGGATTCTGGGTGA
>probe:Drosophila_2:1624590_at:29:717; Interrogation_Position=1123; Antisense; TTCTGGGTGATGTCTTTATTGGCAA
>probe:Drosophila_2:1624590_at:276:353; Interrogation_Position=1144; Antisense; GCAAGTTCTACACGGTTTTCGACAA
>probe:Drosophila_2:1624590_at:685:311; Interrogation_Position=1191; Antisense; GCCAGGGTGGCGGATTATTAACATA
>probe:Drosophila_2:1624590_at:109:93; Interrogation_Position=674; Antisense; AGTTATCTCCTTCTATCTCAAGCGA
>probe:Drosophila_2:1624590_at:276:285; Interrogation_Position=709; Antisense; CTGTGCGCGGTGGAGAACTGATCCT
>probe:Drosophila_2:1624590_at:82:449; Interrogation_Position=728; Antisense; GATCCTGGGCGGTATTGACTCGAGT
>probe:Drosophila_2:1624590_at:547:413; Interrogation_Position=827; Antisense; GACCAATGGCACTTTGCTGTGCAAC
>probe:Drosophila_2:1624590_at:621:621; Interrogation_Position=841; Antisense; TGCTGTGCAACGGATGCCAAGCCAT
>probe:Drosophila_2:1624590_at:704:669; Interrogation_Position=872; Antisense; TACGGGCACCTCCTTAATCGCAGTT
>probe:Drosophila_2:1624590_at:365:719; Interrogation_Position=895; Antisense; TTCCACTGGCCGCTTACAGGAAGAT
>probe:Drosophila_2:1624590_at:300:273; Interrogation_Position=958; Antisense; CATTCGTGAGGTGCGGCCGAGTCTC

Paste this into a BLAST search page for me
AATATCGGTGGTACTGTCTTCACCCAGAATGGCCAAACCTACTGCATGTCGACTAAGCTTCTGGATTCTGGGTGATTCTGGGTGATGTCTTTATTGGCAAGCAAGTTCTACACGGTTTTCGACAAGCCAGGGTGGCGGATTATTAACATAAGTTATCTCCTTCTATCTCAAGCGACTGTGCGCGGTGGAGAACTGATCCTGATCCTGGGCGGTATTGACTCGAGTGACCAATGGCACTTTGCTGTGCAACTGCTGTGCAACGGATGCCAAGCCATTACGGGCACCTCCTTAATCGCAGTTTTCCACTGGCCGCTTACAGGAAGATCATTCGTGAGGTGCGGCCGAGTCTC

Full Affymetrix probeset data:

Annotations for 1624590_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720